EMAIL THIS PAGE TO A FRIEND

TOMM20L

translocase of outer mitochondrial membrane 20 homolog (yeast)-like

Synonyms: UNQ9438
UniProtKB ID: Q6UXN7, B2RPR0
Gene ID:
Mouse(75266) translocase of outer mitochondrial membrane 20 homolog (yeast)-like
Rat(689996) translocase of outer mitochondrial membrane 20 homolog (yeast)-like
domestic cat(101097651) translocase of outer mitochondrial membrane 20 homolog (yeast)-like
dog(611183) translocase of outer mitochondrial membrane 20 homolog (yeast)-like
cow(525594) translocase of outer mitochondrial membrane 20 homolog (yeast)-like
sheep(101116058) translocase of outer mitochondrial membrane 20 homolog (yeast)-like
47 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207377 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207377 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207377 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207377 Rosetta Predictions human pricing
XM_001072851 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207377 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00219148 predicted 281
2 SASI_Hs01_00219149 predicted 221
3 SASI_Hs01_00219150 predicted 207
4 SASI_Hs01_00219151 predicted 282
5 SASI_Hs01_00219152 predicted 268
6 SASI_Hs01_00219153 predicted 317
7 SASI_Hs01_00219155 predicted 345
8 SASI_Hs01_00219156 predicted 292
9 SASI_Hs01_00219157 predicted 222
10 SASI_Hs02_00373981 predicted 215
11 SASI_Hs01_00219154 predicted 276
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072851 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00340670 predicted 659
2 SASI_Rn02_00340671 predicted 29
3 SASI_Rn02_00340672 predicted 487
4 SASI_Rn02_00340673 predicted 642
5 SASI_Rn02_00340674 predicted 604
6 SASI_Rn02_00340675 predicted 346
7 SASI_Rn02_00340676 predicted 611
8 SASI_Rn02_00340677 predicted 432
9 SASI_Rn02_00340678 predicted 51
10 SASI_Rn02_00340679 predicted 555
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207377
TOMM20L MISSION shRNA Bacterial Glycerol Stock
translocase of outer mitochondrial membrane 20 homolog (yeast)-like
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000122564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207377.1-100s1c1
Sequence:CCGGCCTTCGCCTTCCTGGGCTATTCTCGAGAATAGCCCAGGAAGGCGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207377.1-110s1c1
Sequence:CCGGCCTGGGCTATTGTATTTACCTCTCGAGAGGTAAATACAATAGCCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207377.1-363s1c1
Sequence:CCGGCCACGGGAACTTCTGAAAGTTCTCGAGAACTTTCAGAAGTTCCCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207377
TOMM20L MISSION shRNA shRNA Plasmid DNA
translocase of outer mitochondrial membrane 20 homolog (yeast)-like
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000122564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207377.1-100s1c1
Sequence:CCGGCCTTCGCCTTCCTGGGCTATTCTCGAGAATAGCCCAGGAAGGCGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207377.1-110s1c1
Sequence:CCGGCCTGGGCTATTGTATTTACCTCTCGAGAGGTAAATACAATAGCCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207377.1-363s1c1
Sequence:CCGGCCACGGGAACTTCTGAAAGTTCTCGAGAACTTTCAGAAGTTCCCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207377
TOMM20L MISSION shRNA Lentiviral Transduction Particles
translocase of outer mitochondrial membrane 20 homolog (yeast)-like
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000122564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207377.1-100s1c1
Sequence:CCGGCCTTCGCCTTCCTGGGCTATTCTCGAGAATAGCCCAGGAAGGCGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207377.1-110s1c1
Sequence:CCGGCCTGGGCTATTGTATTTACCTCTCGAGAGGTAAATACAATAGCCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207377.1-363s1c1
Sequence:CCGGCCACGGGAACTTCTGAAAGTTCTCGAGAACTTTCAGAAGTTCCCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks