EMAIL THIS PAGE TO A FRIEND

TOMM22

translocase of outer mitochondrial membrane 22 homolog (yeast)

Synonyms: 1C9-2 MST065 MSTP065 TOM22
UniProtKB ID: Q9NS69
Gene ID:
Human(56993) Summary: The protein encoded by this gene is an integral membrane protein of the mitochondrial outer membrane. The encoded protein interacts with TOMM20 and TOMM40, and forms a complex with several other proteins to import cytosolic preproteins into the mitochondrion. [provided by RefSeq, Jul 2008]
Mouse(223696) translocase of outer mitochondrial membrane 22 homolog (yeast)
Rat(300075) translocase of outer mitochondrial membrane 22 homolog (yeast)
domestic guinea pig(100729360) translocase of outer mitochondrial membrane 22 homolog (yeast)
naked mole-rat(101704532) translocase of outer mitochondrial membrane 22 homolog (yeast)
cow(510780) translocase of outer mitochondrial membrane 22 homolog (yeast)
sheep(101105647) translocase of outer mitochondrial membrane 22 homolog (yeast)
Zebrafish(321232) translocase of outer mitochondrial membrane 22 homolog (yeast)
domestic cat(101081394) translocase of outer mitochondrial membrane 22 homolog (yeast)
dog(610117) translocase of outer mitochondrial membrane 22 homolog (yeast)
chicken(770933) translocase of outer mitochondrial membrane 22 homolog (yeast)
53 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020243 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020243 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020243 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172609 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172609 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172609 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020243 Rosetta Predictions human pricing
NM_212514 Rosetta Predictions rat pricing
NM_172609 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020243 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00232707 predicted 281
2 SASI_Hs01_00232708 predicted 290
3 SASI_Hs01_00232709 predicted 286
4 SASI_Hs01_00232710 predicted 299
5 SASI_Hs01_00232711 predicted 284
6 SASI_Hs01_00232712 predicted 272
7 SASI_Hs01_00232714 predicted 480
8 SASI_Hs01_00232715 predicted 480
9 SASI_Hs01_00232716 predicted 333
10 SASI_Hs02_00353198 predicted 438
11 SASI_Hs01_00232713 predicted 298
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212514 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00060712 predicted 215
2 SASI_Rn01_00060713 predicted 221
3 SASI_Rn01_00060715 predicted 265
4 SASI_Rn01_00060716 predicted 249
5 SASI_Rn01_00060718 predicted 261
6 SASI_Rn01_00060719 predicted 287
7 SASI_Rn01_00060720 predicted 205
8 SASI_Rn01_00060721 predicted 199
9 SASI_Rn02_00270518 predicted 266
10 SASI_Rn02_00270519 predicted 230
11 SASI_Rn01_00060714 predicted 277
12 SASI_Rn01_00060717 predicted 234
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172609 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00198710 predicted 720
2 SASI_Mm01_00198711 predicted 859
3 SASI_Mm01_00198712 predicted 826
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020243
VALIDATED
TOMM22 MISSION shRNA Bacterial Glycerol Stock
translocase of outer mitochondrial membrane 22 homolog (yeast)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000060883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A3
TRC Version: 1 Clone ID:NM_020243.3-356s1c1
Sequence:CCGGGCAGATACTTCTAGGACCTAACTCGAGTTAGGTCCTAGAAGTATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_020243.3-213s1c1
Sequence:CCGGTCCCTCTTTGTGGCTCAGAAACTCGAGTTTCTGAGCCACAAAGAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_020243.3-299s1c1
Sequence:CCGGCGTTGTCTTTGAGACGGAGAACTCGAGTTCTCCGTCTCAAAGACAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020243.3-51s1c1
Sequence:CCGGCCGGACGAATTGCTCCCGAAACTCGAGTTTCGGGAGCAATTCGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020243.4-229s21c1
Sequence:GTACCGGTTTGATCTTTCCCTCTTTGTGCTCGAGCACAAAGAGGGAAAGATCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230173    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020243.4-678s21c1
Sequence:CCGGGCAGCCATGCAGATGGTTATTCTCGAGAATAACCATCTGCATGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020243.4-447s21c1
Sequence:CCGGTGGAAAGATCTAGATTGTTATCTCGAGATAACAATCTAGATCTTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020243.4-382s21c1
Sequence:CCGGCAGATACTTCTAGGACCTAACCTCGAGGTTAGGTCCTAGAAGTATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020243.4-333s21c1
Sequence:CCGGTGAGACGGAGAAGTTGCAAATCTCGAGATTTGCAACTTCTCCGTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020243
VALIDATED
TOMM22 MISSION shRNA shRNA Plasmid DNA
translocase of outer mitochondrial membrane 22 homolog (yeast)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000060883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A3
TRC Version: 1 Clone ID:NM_020243.3-356s1c1
Sequence:CCGGGCAGATACTTCTAGGACCTAACTCGAGTTAGGTCCTAGAAGTATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_020243.3-213s1c1
Sequence:CCGGTCCCTCTTTGTGGCTCAGAAACTCGAGTTTCTGAGCCACAAAGAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_020243.3-299s1c1
Sequence:CCGGCGTTGTCTTTGAGACGGAGAACTCGAGTTCTCCGTCTCAAAGACAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020243.3-51s1c1
Sequence:CCGGCCGGACGAATTGCTCCCGAAACTCGAGTTTCGGGAGCAATTCGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020243.4-229s21c1
Sequence:GTACCGGTTTGATCTTTCCCTCTTTGTGCTCGAGCACAAAGAGGGAAAGATCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230173    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020243.4-678s21c1
Sequence:CCGGGCAGCCATGCAGATGGTTATTCTCGAGAATAACCATCTGCATGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020243.4-447s21c1
Sequence:CCGGTGGAAAGATCTAGATTGTTATCTCGAGATAACAATCTAGATCTTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020243.4-382s21c1
Sequence:CCGGCAGATACTTCTAGGACCTAACCTCGAGGTTAGGTCCTAGAAGTATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020243.4-333s21c1
Sequence:CCGGTGAGACGGAGAAGTTGCAAATCTCGAGATTTGCAACTTCTCCGTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020243
VALIDATED
TOMM22 MISSION shRNA Lentiviral Transduction Particles
translocase of outer mitochondrial membrane 22 homolog (yeast)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000060883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A3
TRC Version: 1 Clone ID:NM_020243.3-356s1c1
Sequence:CCGGGCAGATACTTCTAGGACCTAACTCGAGTTAGGTCCTAGAAGTATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_020243.3-213s1c1
Sequence:CCGGTCCCTCTTTGTGGCTCAGAAACTCGAGTTTCTGAGCCACAAAGAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_020243.3-299s1c1
Sequence:CCGGCGTTGTCTTTGAGACGGAGAACTCGAGTTCTCCGTCTCAAAGACAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020243.3-51s1c1
Sequence:CCGGCCGGACGAATTGCTCCCGAAACTCGAGTTTCGGGAGCAATTCGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020243.4-229s21c1
Sequence:GTACCGGTTTGATCTTTCCCTCTTTGTGCTCGAGCACAAAGAGGGAAAGATCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230173    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020243.4-678s21c1
Sequence:CCGGGCAGCCATGCAGATGGTTATTCTCGAGAATAACCATCTGCATGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020243.4-447s21c1
Sequence:CCGGTGGAAAGATCTAGATTGTTATCTCGAGATAACAATCTAGATCTTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020243.4-382s21c1
Sequence:CCGGCAGATACTTCTAGGACCTAACCTCGAGGTTAGGTCCTAGAAGTATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020243.4-333s21c1
Sequence:CCGGTGAGACGGAGAAGTTGCAAATCTCGAGATTTGCAACTTCTCCGTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172609
VALIDATED
TOMM22 MISSION shRNA Bacterial Glycerol Stock
translocase of outer mitochondrial membrane 22 homolog (yeast)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000087473    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172609.2-547s1c1
Sequence:CCGGCCTTGGCACATGGATCTATTTCTCGAGAAATAGATCCATGTGCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172609.2-84s1c1
Sequence:CCGGCCCGAAAGCCGAGGCAGAGAACTCGAGTTCTCTGCCTCGGCTTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172609.2-275s1c1
Sequence:CCGGCTTTGTGGATTGGGACCACTTCTCGAGAAGTGGTCCCAATCCACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172609.2-129s1c1
Sequence:CCGGCGACGACGACGAGCTAGACGACTCGAGTCGTCTAGCTCGTCGTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172609.2-70s1c1
Sequence:CCGGCCCGAGGAATTACTCCCGAAACTCGAGTTTCGGGAGTAATTCCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172609.3-84s21c1
Sequence:CCGGCCCGAAAGCCGAGGCAGAGAACTCGAGTTCTCTGCCTCGGCTTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352116    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172609.3-547s21c1
Sequence:CCGGCCTTGGCACATGGATCTATTTCTCGAGAAATAGATCCATGTGCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172609.3-451s21c1
Sequence:CCGGTAGATTCTTCCTTCGGTATTTCTCGAGAAATACCGAAGGAAGAATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172609.3-129s21c1
Sequence:CCGGCGACGACGACGAGCTAGACGACTCGAGTCGTCTAGCTCGTCGTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172609
VALIDATED
TOMM22 MISSION shRNA shRNA Plasmid DNA
translocase of outer mitochondrial membrane 22 homolog (yeast)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000087473    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172609.2-547s1c1
Sequence:CCGGCCTTGGCACATGGATCTATTTCTCGAGAAATAGATCCATGTGCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172609.2-84s1c1
Sequence:CCGGCCCGAAAGCCGAGGCAGAGAACTCGAGTTCTCTGCCTCGGCTTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172609.2-275s1c1
Sequence:CCGGCTTTGTGGATTGGGACCACTTCTCGAGAAGTGGTCCCAATCCACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172609.2-129s1c1
Sequence:CCGGCGACGACGACGAGCTAGACGACTCGAGTCGTCTAGCTCGTCGTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172609.2-70s1c1
Sequence:CCGGCCCGAGGAATTACTCCCGAAACTCGAGTTTCGGGAGTAATTCCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172609.3-84s21c1
Sequence:CCGGCCCGAAAGCCGAGGCAGAGAACTCGAGTTCTCTGCCTCGGCTTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352116    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172609.3-547s21c1
Sequence:CCGGCCTTGGCACATGGATCTATTTCTCGAGAAATAGATCCATGTGCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172609.3-451s21c1
Sequence:CCGGTAGATTCTTCCTTCGGTATTTCTCGAGAAATACCGAAGGAAGAATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172609.3-129s21c1
Sequence:CCGGCGACGACGACGAGCTAGACGACTCGAGTCGTCTAGCTCGTCGTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172609
VALIDATED
TOMM22 MISSION shRNA Lentiviral Transduction Particles
translocase of outer mitochondrial membrane 22 homolog (yeast)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000087473    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172609.2-547s1c1
Sequence:CCGGCCTTGGCACATGGATCTATTTCTCGAGAAATAGATCCATGTGCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172609.2-84s1c1
Sequence:CCGGCCCGAAAGCCGAGGCAGAGAACTCGAGTTCTCTGCCTCGGCTTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172609.2-275s1c1
Sequence:CCGGCTTTGTGGATTGGGACCACTTCTCGAGAAGTGGTCCCAATCCACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172609.2-129s1c1
Sequence:CCGGCGACGACGACGAGCTAGACGACTCGAGTCGTCTAGCTCGTCGTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172609.2-70s1c1
Sequence:CCGGCCCGAGGAATTACTCCCGAAACTCGAGTTTCGGGAGTAATTCCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172609.3-84s21c1
Sequence:CCGGCCCGAAAGCCGAGGCAGAGAACTCGAGTTCTCTGCCTCGGCTTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352116    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172609.3-547s21c1
Sequence:CCGGCCTTGGCACATGGATCTATTTCTCGAGAAATAGATCCATGTGCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172609.3-451s21c1
Sequence:CCGGTAGATTCTTCCTTCGGTATTTCTCGAGAAATACCGAAGGAAGAATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172609.3-129s21c1
Sequence:CCGGCGACGACGACGAGCTAGACGACTCGAGTCGTCTAGCTCGTCGTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks