EMAIL THIS PAGE TO A FRIEND

TOMM22P3

translocase of outer mitochondrial membrane 22 homolog (yeast) pseudogene 3

Species: Human TOMM22P3(122038)
Gene ID:
Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_062912
TOMM22P3 MISSION shRNA Bacterial Glycerol Stock
translocase of outer mitochondrial membrane 22 homolog (yeast) pseudogene 3
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000204609    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_062912.1-34s1c1
Sequence:CCGGCGGTGGATAAATTGCTGCCAACTCGAGTTGGCAGCAATTTATCCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000204381    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_062912.1-29s1c1
Sequence:CCGGCCTGTCGGTGGATAAATTGCTCTCGAGAGCAATTTATCCACCGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000187973    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_062912.1-228s1c1
Sequence:CCGGCTTGTGGATTGGAACCTCTTTCTCGAGAAAGAGGTTCCAATCCACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_062912
TOMM22P3 MISSION shRNA shRNA Plasmid DNA
translocase of outer mitochondrial membrane 22 homolog (yeast) pseudogene 3
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000204609    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_062912.1-34s1c1
Sequence:CCGGCGGTGGATAAATTGCTGCCAACTCGAGTTGGCAGCAATTTATCCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000204381    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_062912.1-29s1c1
Sequence:CCGGCCTGTCGGTGGATAAATTGCTCTCGAGAGCAATTTATCCACCGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000187973    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_062912.1-228s1c1
Sequence:CCGGCTTGTGGATTGGAACCTCTTTCTCGAGAAAGAGGTTCCAATCCACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_062912
TOMM22P3 MISSION shRNA Lentiviral Transduction Particles
translocase of outer mitochondrial membrane 22 homolog (yeast) pseudogene 3
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000204609    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_062912.1-34s1c1
Sequence:CCGGCGGTGGATAAATTGCTGCCAACTCGAGTTGGCAGCAATTTATCCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000204381    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_062912.1-29s1c1
Sequence:CCGGCCTGTCGGTGGATAAATTGCTCTCGAGAGCAATTTATCCACCGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000187973    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_062912.1-228s1c1
Sequence:CCGGCTTGTGGATTGGAACCTCTTTCTCGAGAAAGAGGTTCCAATCCACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks