EMAIL THIS PAGE TO A FRIEND

TOMM34

translocase of outer mitochondrial membrane 34

Synonyms: HTOM34P TOM34 URCC3
UniProtKB ID: Q15785, Q53GH9, Q6IBN7, Q9NTZ3
Gene ID:
Human(10953) Summary: The protein encoded by this gene is involved in the import of precursor proteins into mitochondria. The encoded protein has a chaperone-like activity, binding the mature portion of unfolded proteins and aiding their import into mitochondria. This protein, which is found in the cytoplasm and sometimes associated with the outer mitochondrial membrane, has a weak ATPase activity and contains 6 TPR repeats. [provided by RefSeq, Jul 2008]
Mouse(67145) translocase of outer mitochondrial membrane 34
Rat(311621) translocase of outer mitochondrial membrane 34
Zebrafish(323361) translocase of outer mitochondrial membrane 34
dog(477239) translocase of outer mitochondrial membrane 34
domestic cat(101091435) translocase of outer mitochondrial membrane 34
chicken(419188) translocase of outer mitochondrial membrane 34
cow(508142) translocase of outer mitochondrial membrane 34
sheep(101107622) translocase of outer mitochondrial membrane 34
naked mole-rat(101704036) translocase of outer mitochondrial membrane 34
domestic guinea pig(100721695) translocase of outer mitochondrial membrane 34
54 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006809 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006809 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006809 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025996 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025996 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025996 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006809 Rosetta Predictions human pricing
NM_001044244 Rosetta Predictions rat pricing
NM_025996 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006809 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00172451 predicted 411
2 SASI_Hs02_00342338 predicted 420
3 SASI_Hs02_00342339 predicted 658
4 SASI_Hs01_00172452 predicted 497
5 SASI_Hs01_00172453 predicted 946
6 SASI_Hs01_00172454 predicted 1009
7 SASI_Hs01_00172456 predicted 370
8 SASI_Hs01_00172457 predicted 740
9 SASI_Hs01_00172459 predicted 911
10 SASI_Hs01_00172460 predicted 810
11 SASI_Hs01_00172455 predicted 734
12 SASI_Hs01_00172458 predicted 881
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001044244 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00205167 predicted 602
2 SASI_Rn02_00205168 predicted 886
3 SASI_Rn02_00205169 predicted 826
4 SASI_Rn02_00205170 predicted 790
5 SASI_Rn02_00205171 predicted 543
6 SASI_Rn02_00205172 predicted 663
7 SASI_Rn02_00205173 predicted 692
8 SASI_Rn02_00205174 predicted 926
9 SASI_Rn02_00205175 predicted 328
10 SASI_Rn02_00205176 predicted 624
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025996 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00108170 predicted 777
2 SASI_Mm01_00108171 predicted 875
3 SASI_Mm02_00329449 predicted 1397
4 SASI_Mm01_00108172 predicted 1326
5 SASI_Mm01_00108173 predicted 1176
6 SASI_Mm01_00108174 predicted 941
7 SASI_Mm01_00108176 predicted 831
8 SASI_Mm01_00108177 predicted 704
9 SASI_Mm01_00108178 predicted 1118
10 SASI_Mm01_00108179 predicted 683
11 SASI_Mm01_00108175 predicted 1237
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006809
VALIDATED
TOMM34 MISSION shRNA Bacterial Glycerol Stock
translocase of outer mitochondrial membrane 34
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166639    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006809.4-1857s1c1
Sequence:CCGGCCGGGCTTCATAGTTCTTTGTCTCGAGACAAAGAACTATGAAGCCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165754    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006809.4-797s1c1
Sequence:CCGGCCTCTTGTGTAGTAACCTGGACTCGAGTCCAGGTTACTACACAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165176    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006809.4-855s1c1
Sequence:CCGGGTCCTGAAGCAGTACACAGAACTCGAGTTCTGTGTACTGCTTCAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006809.4-312s1c1
Sequence:CCGGGCAGCATGTCACTTGAAGGATCTCGAGATCCTTCAAGTGACATGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006809.4-863s1c1
Sequence:CCGGGCAGTACACAGAAGCAGTGAACTCGAGTTCACTGCTTCTGTGTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162053    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006809.4-1360s1c1
Sequence:CCGGGATCCTCATCAGCAAAGCATTCTCGAGAATGCTTTGCTGATGAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162421    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006809.4-1858s1c1
Sequence:CCGGCGGGCTTCATAGTTCTTTGTACTCGAGTACAAAGAACTATGAAGCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006809.4-863s21c1
Sequence:CCGGGCAGTACACAGAAGCAGTGAACTCGAGTTCACTGCTTCTGTGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292356    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006809.4-1857s21c1
Sequence:CCGGCCGGGCTTCATAGTTCTTTGTCTCGAGACAAAGAACTATGAAGCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292357    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006809.4-1360s21c1
Sequence:CCGGGATCCTCATCAGCAAAGCATTCTCGAGAATGCTTTGCTGATGAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006809.4-312s21c1
Sequence:CCGGGCAGCATGTCACTTGAAGGATCTCGAGATCCTTCAAGTGACATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006809
VALIDATED
TOMM34 MISSION shRNA shRNA Plasmid DNA
translocase of outer mitochondrial membrane 34
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166639    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006809.4-1857s1c1
Sequence:CCGGCCGGGCTTCATAGTTCTTTGTCTCGAGACAAAGAACTATGAAGCCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165754    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006809.4-797s1c1
Sequence:CCGGCCTCTTGTGTAGTAACCTGGACTCGAGTCCAGGTTACTACACAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165176    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006809.4-855s1c1
Sequence:CCGGGTCCTGAAGCAGTACACAGAACTCGAGTTCTGTGTACTGCTTCAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006809.4-312s1c1
Sequence:CCGGGCAGCATGTCACTTGAAGGATCTCGAGATCCTTCAAGTGACATGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006809.4-863s1c1
Sequence:CCGGGCAGTACACAGAAGCAGTGAACTCGAGTTCACTGCTTCTGTGTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162053    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006809.4-1360s1c1
Sequence:CCGGGATCCTCATCAGCAAAGCATTCTCGAGAATGCTTTGCTGATGAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162421    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006809.4-1858s1c1
Sequence:CCGGCGGGCTTCATAGTTCTTTGTACTCGAGTACAAAGAACTATGAAGCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006809.4-863s21c1
Sequence:CCGGGCAGTACACAGAAGCAGTGAACTCGAGTTCACTGCTTCTGTGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292356    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006809.4-1857s21c1
Sequence:CCGGCCGGGCTTCATAGTTCTTTGTCTCGAGACAAAGAACTATGAAGCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292357    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006809.4-1360s21c1
Sequence:CCGGGATCCTCATCAGCAAAGCATTCTCGAGAATGCTTTGCTGATGAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006809.4-312s21c1
Sequence:CCGGGCAGCATGTCACTTGAAGGATCTCGAGATCCTTCAAGTGACATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006809
VALIDATED
TOMM34 MISSION shRNA Lentiviral Transduction Particles
translocase of outer mitochondrial membrane 34
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166639    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006809.4-1857s1c1
Sequence:CCGGCCGGGCTTCATAGTTCTTTGTCTCGAGACAAAGAACTATGAAGCCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165754    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006809.4-797s1c1
Sequence:CCGGCCTCTTGTGTAGTAACCTGGACTCGAGTCCAGGTTACTACACAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165176    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006809.4-855s1c1
Sequence:CCGGGTCCTGAAGCAGTACACAGAACTCGAGTTCTGTGTACTGCTTCAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006809.4-312s1c1
Sequence:CCGGGCAGCATGTCACTTGAAGGATCTCGAGATCCTTCAAGTGACATGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006809.4-863s1c1
Sequence:CCGGGCAGTACACAGAAGCAGTGAACTCGAGTTCACTGCTTCTGTGTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162053    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006809.4-1360s1c1
Sequence:CCGGGATCCTCATCAGCAAAGCATTCTCGAGAATGCTTTGCTGATGAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162421    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006809.4-1858s1c1
Sequence:CCGGCGGGCTTCATAGTTCTTTGTACTCGAGTACAAAGAACTATGAAGCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006809.4-863s21c1
Sequence:CCGGGCAGTACACAGAAGCAGTGAACTCGAGTTCACTGCTTCTGTGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292356    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006809.4-1857s21c1
Sequence:CCGGCCGGGCTTCATAGTTCTTTGTCTCGAGACAAAGAACTATGAAGCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292357    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006809.4-1360s21c1
Sequence:CCGGGATCCTCATCAGCAAAGCATTCTCGAGAATGCTTTGCTGATGAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006809.4-312s21c1
Sequence:CCGGGCAGCATGTCACTTGAAGGATCTCGAGATCCTTCAAGTGACATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025996
VALIDATED
TOMM34 MISSION shRNA Bacterial Glycerol Stock
translocase of outer mitochondrial membrane 34
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000114199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025996.1-1371s1c1
Sequence:CCGGCTACAAATTGAACCCAGGAATCTCGAGATTCCTGGGTTCAATTTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025996.1-1232s1c1
Sequence:CCGGGCAGTACAAGGAGGCAGTAAACTCGAGTTTACTGCCTCCTTGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025996.1-1412s1c1
Sequence:CCGGGCAGGAAGTTAACCAGAACATCTCGAGATGTTCTGGTTAACTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114196    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025996.1-2088s1c1
Sequence:CCGGCGATGTTCAAAGAGCCCAGATCTCGAGATCTGGGCTCTTTGAACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025996.1-1115s1c1
Sequence:CCGGCCTTGTAAAGAAGGGCAACCACTCGAGTGGTTGCCCTTCTTTACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025996.4-1232s21c1
Sequence:CCGGGCAGTACAAGGAGGCAGTAAACTCGAGTTTACTGCCTCCTTGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025996.4-1115s21c1
Sequence:CCGGCCTTGTAAAGAAGGGCAACCACTCGAGTGGTTGCCCTTCTTTACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309385    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025996.4-2088s21c1
Sequence:CCGGCGATGTTCAAAGAGCCCAGATCTCGAGATCTGGGCTCTTTGAACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025996.4-1412s21c1
Sequence:CCGGGCAGGAAGTTAACCAGAACATCTCGAGATGTTCTGGTTAACTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025996.4-1371s21c1
Sequence:CCGGCTACAAATTGAACCCAGGAATCTCGAGATTCCTGGGTTCAATTTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025996
VALIDATED
TOMM34 MISSION shRNA shRNA Plasmid DNA
translocase of outer mitochondrial membrane 34
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000114199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025996.1-1371s1c1
Sequence:CCGGCTACAAATTGAACCCAGGAATCTCGAGATTCCTGGGTTCAATTTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025996.1-1232s1c1
Sequence:CCGGGCAGTACAAGGAGGCAGTAAACTCGAGTTTACTGCCTCCTTGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025996.1-1412s1c1
Sequence:CCGGGCAGGAAGTTAACCAGAACATCTCGAGATGTTCTGGTTAACTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114196    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025996.1-2088s1c1
Sequence:CCGGCGATGTTCAAAGAGCCCAGATCTCGAGATCTGGGCTCTTTGAACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025996.1-1115s1c1
Sequence:CCGGCCTTGTAAAGAAGGGCAACCACTCGAGTGGTTGCCCTTCTTTACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025996.4-1232s21c1
Sequence:CCGGGCAGTACAAGGAGGCAGTAAACTCGAGTTTACTGCCTCCTTGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025996.4-1115s21c1
Sequence:CCGGCCTTGTAAAGAAGGGCAACCACTCGAGTGGTTGCCCTTCTTTACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309385    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025996.4-2088s21c1
Sequence:CCGGCGATGTTCAAAGAGCCCAGATCTCGAGATCTGGGCTCTTTGAACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025996.4-1412s21c1
Sequence:CCGGGCAGGAAGTTAACCAGAACATCTCGAGATGTTCTGGTTAACTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025996.4-1371s21c1
Sequence:CCGGCTACAAATTGAACCCAGGAATCTCGAGATTCCTGGGTTCAATTTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025996
VALIDATED
TOMM34 MISSION shRNA Lentiviral Transduction Particles
translocase of outer mitochondrial membrane 34
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000114199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025996.1-1371s1c1
Sequence:CCGGCTACAAATTGAACCCAGGAATCTCGAGATTCCTGGGTTCAATTTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025996.1-1232s1c1
Sequence:CCGGGCAGTACAAGGAGGCAGTAAACTCGAGTTTACTGCCTCCTTGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025996.1-1412s1c1
Sequence:CCGGGCAGGAAGTTAACCAGAACATCTCGAGATGTTCTGGTTAACTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114196    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025996.1-2088s1c1
Sequence:CCGGCGATGTTCAAAGAGCCCAGATCTCGAGATCTGGGCTCTTTGAACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025996.1-1115s1c1
Sequence:CCGGCCTTGTAAAGAAGGGCAACCACTCGAGTGGTTGCCCTTCTTTACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025996.4-1232s21c1
Sequence:CCGGGCAGTACAAGGAGGCAGTAAACTCGAGTTTACTGCCTCCTTGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025996.4-1115s21c1
Sequence:CCGGCCTTGTAAAGAAGGGCAACCACTCGAGTGGTTGCCCTTCTTTACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309385    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025996.4-2088s21c1
Sequence:CCGGCGATGTTCAAAGAGCCCAGATCTCGAGATCTGGGCTCTTTGAACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025996.4-1412s21c1
Sequence:CCGGGCAGGAAGTTAACCAGAACATCTCGAGATGTTCTGGTTAACTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025996.4-1371s21c1
Sequence:CCGGCTACAAATTGAACCCAGGAATCTCGAGATTCCTGGGTTCAATTTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks