EMAIL THIS PAGE TO A FRIEND

TOMM40

translocase of outer mitochondrial membrane 40 homolog (yeast)

Synonyms: C19orf1 D19S1177E PER-EC1 PEREC1 TOM40
UniProtKB ID: O96008, Q86VW4, Q8WY09, Q8WY10, Q8WY11, Q9BR95
Gene ID:
Human(10452) Summary: TOMM40 is the channel-forming subunit of the translocase of the mitochondrial outer membrane (TOM) complex that is essential for protein import into mitochondria (Humphries et al., 2005 [PubMed 15644312]
Mouse(53333) translocase of outer mitochondrial membrane 40 homolog (yeast)
Rat(308416) translocase of outer mitochondrial membrane 40 homolog (yeast)
domestic guinea pig(100731084) translocase of outer mitochondrial membrane 40 homolog (yeast)
naked mole-rat(101716859) translocase of outer mitochondrial membrane 40 homolog (yeast)
cow(510219) translocase of outer mitochondrial membrane 40 homolog (yeast)
sheep(101111570) translocase of outer mitochondrial membrane 40 homolog (yeast)
Zebrafish(322645) translocase of outer mitochondrial membrane 40 homolog (yeast)
dog(611055) translocase of outer mitochondrial membrane 40 homolog (yeast)
domestic cat(101097114) translocase of outer mitochondrial membrane 40 homolog (yeast)
93 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016871 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016871 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016871 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006114 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006114 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006114 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU114031 MISSION® esiRNA esiRNA human TOMM40 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006114 Rosetta Predictions human pricing
NM_212520 Rosetta Predictions rat pricing
NM_001109748 Rosetta Predictions mouse pricing
NM_016871 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006114 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00340928 predicted 934
2 SASI_Hs01_00188181 predicted 852
3 SASI_Hs01_00188183 predicted 736
4 SASI_Hs02_00340929 predicted 888
5 SASI_Hs02_00340930 predicted 887
6 SASI_Hs01_00188185 predicted 623
7 SASI_Hs02_00340931 predicted 887
8 SASI_Hs01_00188186 predicted 828
9 SASI_Hs01_00188187 predicted 523
10 SASI_Hs01_00188188 predicted 593
11 SASI_Hs01_00188182 predicted 812
12 SASI_Hs01_00188184 predicted 430
13 SASI_Hs01_00188189 predicted 720
14 SASI_Hs01_00188190 predicted 440
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212520 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00053217 predicted 797
2 SASI_Rn01_00053218 predicted 769
3 SASI_Rn01_00053219 predicted 646
4 SASI_Rn01_00053220 predicted 281
5 SASI_Rn02_00270534 predicted 461
6 SASI_Rn01_00053222 predicted 613
7 SASI_Rn01_00053223 predicted 730
8 SASI_Rn01_00053224 predicted 642
9 SASI_Rn01_00053225 predicted 339
10 SASI_Rn01_00053226 predicted 568
11 SASI_Rn01_00053221 predicted 517
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109748 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00304234 predicted 740
2 SASI_Mm02_00304235 predicted 457
3 SASI_Mm02_00304236 predicted 830
4 SASI_Mm02_00304237 predicted 936
5 SASI_Mm02_00304238 predicted 973
6 SASI_Mm02_00304239 predicted 909
7 SASI_Mm02_00304240 predicted 791
8 SASI_Mm02_00304241 predicted 811
9 SASI_Mm02_00304242 predicted 478
10 SASI_Mm02_00304243 predicted 718
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016871 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00323665 predicted 650
2 SASI_Mm01_00105373 predicted 364
3 SASI_Mm02_00323666 predicted 724
4 SASI_Mm01_00105375 predicted 838
5 SASI_Mm01_00105376 predicted 882
6 SASI_Mm01_00105377 predicted 812
7 SASI_Mm02_00323667 predicted 690
8 SASI_Mm02_00323668 predicted 716
9 SASI_Mm01_00105380 predicted 388
10 SASI_Mm02_00323669 predicted 615
11 SASI_Mm01_00105374 predicted 356
12 SASI_Mm01_00105378 predicted 278
13 SASI_Mm01_00105379 predicted 289
14 SASI_Mm01_00105381 predicted 659
15 SASI_Mm01_00105382 predicted 659
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016871
VALIDATED
TOMM40 MISSION shRNA Bacterial Glycerol Stock
translocase of outer mitochondrial membrane 40 homolog (yeast)
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000279346    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016871.2-1392s21c1
Sequence:CCGGCTCAGAAAGGAAAGACTTGATCTCGAGATCAAGTCTTTCCTTTCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016871.2-1124s21c1
Sequence:CCGGGAATAAGTTCCTGTGTGGCTTCTCGAGAAGCCACACAGGAACTTATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216664    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016871.2-818s1c1
Sequence:CCGGCATGTCTCTAGCTGGGAAATACTCGAGTATTTCCCAGCTAGAGACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215458    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016871.2-378s1c1
Sequence:CCGGGTCAAACTTACAGTCAACAAACTCGAGTTTGTTGACTGTAAGTTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016871.2-848s21c1
Sequence:CCGGCAACTGGTTGGCTACAGTAACCTCGAGGTTACTGTAGCCAACCAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016871.2-451s21c1
Sequence:CCGGGGGAGTCCAACTACCACTTTGCTCGAGCAAAGTGGTAGTTGGACTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016871.2-363s21c1
Sequence:CCGGGTTCAGATGGAAGGTGTCAAACTCGAGTTTGACACCTTCCATCTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016871.1-900s1c1
Sequence:CCGGGAATAAGTTCCTGTGTGGCTTCTCGAGAAGCCACACAGGAACTTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016871.1-663s1c1
Sequence:CCGGGCATGCGACGTATTACCACAACTCGAGTTGTGGTAATACGTCGCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174504    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016871.1-1168s1c1
Sequence:CCGGCTCAGAAAGGAAAGACTTGATCTCGAGATCAAGTCTTTCCTTTCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016871.1-289s1c1
Sequence:CCGGGTTCAGATGGAAGGTGTCAAACTCGAGTTTGACACCTTCCATCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193805    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016871.1-801s1c1
Sequence:CCGGCTCTGTGAACAGTAACTGGATCTCGAGATCCAGTTACTGTTCACAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016871
VALIDATED
TOMM40 MISSION shRNA shRNA Plasmid DNA
translocase of outer mitochondrial membrane 40 homolog (yeast)
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000279346    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016871.2-1392s21c1
Sequence:CCGGCTCAGAAAGGAAAGACTTGATCTCGAGATCAAGTCTTTCCTTTCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016871.2-1124s21c1
Sequence:CCGGGAATAAGTTCCTGTGTGGCTTCTCGAGAAGCCACACAGGAACTTATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216664    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016871.2-818s1c1
Sequence:CCGGCATGTCTCTAGCTGGGAAATACTCGAGTATTTCCCAGCTAGAGACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215458    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016871.2-378s1c1
Sequence:CCGGGTCAAACTTACAGTCAACAAACTCGAGTTTGTTGACTGTAAGTTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016871.2-848s21c1
Sequence:CCGGCAACTGGTTGGCTACAGTAACCTCGAGGTTACTGTAGCCAACCAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016871.2-451s21c1
Sequence:CCGGGGGAGTCCAACTACCACTTTGCTCGAGCAAAGTGGTAGTTGGACTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016871.2-363s21c1
Sequence:CCGGGTTCAGATGGAAGGTGTCAAACTCGAGTTTGACACCTTCCATCTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016871.1-900s1c1
Sequence:CCGGGAATAAGTTCCTGTGTGGCTTCTCGAGAAGCCACACAGGAACTTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016871.1-663s1c1
Sequence:CCGGGCATGCGACGTATTACCACAACTCGAGTTGTGGTAATACGTCGCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174504    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016871.1-1168s1c1
Sequence:CCGGCTCAGAAAGGAAAGACTTGATCTCGAGATCAAGTCTTTCCTTTCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016871.1-289s1c1
Sequence:CCGGGTTCAGATGGAAGGTGTCAAACTCGAGTTTGACACCTTCCATCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193805    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016871.1-801s1c1
Sequence:CCGGCTCTGTGAACAGTAACTGGATCTCGAGATCCAGTTACTGTTCACAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016871
VALIDATED
TOMM40 MISSION shRNA Lentiviral Transduction Particles
translocase of outer mitochondrial membrane 40 homolog (yeast)
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000279346    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016871.2-1392s21c1
Sequence:CCGGCTCAGAAAGGAAAGACTTGATCTCGAGATCAAGTCTTTCCTTTCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016871.2-1124s21c1
Sequence:CCGGGAATAAGTTCCTGTGTGGCTTCTCGAGAAGCCACACAGGAACTTATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216664    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016871.2-818s1c1
Sequence:CCGGCATGTCTCTAGCTGGGAAATACTCGAGTATTTCCCAGCTAGAGACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215458    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016871.2-378s1c1
Sequence:CCGGGTCAAACTTACAGTCAACAAACTCGAGTTTGTTGACTGTAAGTTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016871.2-848s21c1
Sequence:CCGGCAACTGGTTGGCTACAGTAACCTCGAGGTTACTGTAGCCAACCAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016871.2-451s21c1
Sequence:CCGGGGGAGTCCAACTACCACTTTGCTCGAGCAAAGTGGTAGTTGGACTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016871.2-363s21c1
Sequence:CCGGGTTCAGATGGAAGGTGTCAAACTCGAGTTTGACACCTTCCATCTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016871.1-900s1c1
Sequence:CCGGGAATAAGTTCCTGTGTGGCTTCTCGAGAAGCCACACAGGAACTTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016871.1-663s1c1
Sequence:CCGGGCATGCGACGTATTACCACAACTCGAGTTGTGGTAATACGTCGCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174504    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016871.1-1168s1c1
Sequence:CCGGCTCAGAAAGGAAAGACTTGATCTCGAGATCAAGTCTTTCCTTTCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016871.1-289s1c1
Sequence:CCGGGTTCAGATGGAAGGTGTCAAACTCGAGTTTGACACCTTCCATCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193805    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016871.1-801s1c1
Sequence:CCGGCTCTGTGAACAGTAACTGGATCTCGAGATCCAGTTACTGTTCACAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006114
VALIDATED
TOMM40 MISSION shRNA Bacterial Glycerol Stock
translocase of outer mitochondrial membrane 40 homolog (yeast)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000231153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_006114.2-913s21c1
Sequence:CCGGACGCAACATACTACCACAAAGCTCGAGCTTTGTGGTAGTATGTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231155    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_006114.2-1362s21c1
Sequence:CCGGTGAATGGCGCTTCGGGATTCTCTCGAGAGAATCCCGAAGCGCCATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_006114.2-419s21c1
Sequence:GTACCGGCAAAGGGTTGAGTAACCATTTCTCGAGAAATGGTTACTCAACCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_006114.2-1138s21c1
Sequence:CCGGATCACCGCAAGAACAAGTTTCCTCGAGGAAACTTGTTCTTGCGGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_006114.2-842s21c1
Sequence:CCGGCATGTCTCTAGCTGGGAAATACTCGAGTATTTCCCAGCTAGAGACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006114.1-894s1c1
Sequence:CCGGGCACGCAACATACTACCACAACTCGAGTTGTGGTAGTATGTTGCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006114.1-390s1c1
Sequence:CCGGGCTCACAGTCAACAAAGGGTTCTCGAGAACCCTTTGTTGACTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006114.1-1126s1c1
Sequence:CCGGCGCAAGAACAAGTTTCAGTGTCTCGAGACACTGAAACTTGTTCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006114.1-1113s1c1
Sequence:CCGGCTTCCTGAATCACCGCAAGAACTCGAGTTCTTGCGGTGATTCAGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006114.1-624s1c1
Sequence:CCGGCCAGCAGTCGAAGTTTGTGAACTCGAGTTCACAAACTTCGACTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006114
VALIDATED
TOMM40 MISSION shRNA shRNA Plasmid DNA
translocase of outer mitochondrial membrane 40 homolog (yeast)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000231153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_006114.2-913s21c1
Sequence:CCGGACGCAACATACTACCACAAAGCTCGAGCTTTGTGGTAGTATGTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231155    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_006114.2-1362s21c1
Sequence:CCGGTGAATGGCGCTTCGGGATTCTCTCGAGAGAATCCCGAAGCGCCATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_006114.2-419s21c1
Sequence:GTACCGGCAAAGGGTTGAGTAACCATTTCTCGAGAAATGGTTACTCAACCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_006114.2-1138s21c1
Sequence:CCGGATCACCGCAAGAACAAGTTTCCTCGAGGAAACTTGTTCTTGCGGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_006114.2-842s21c1
Sequence:CCGGCATGTCTCTAGCTGGGAAATACTCGAGTATTTCCCAGCTAGAGACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006114.1-894s1c1
Sequence:CCGGGCACGCAACATACTACCACAACTCGAGTTGTGGTAGTATGTTGCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006114.1-390s1c1
Sequence:CCGGGCTCACAGTCAACAAAGGGTTCTCGAGAACCCTTTGTTGACTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006114.1-1126s1c1
Sequence:CCGGCGCAAGAACAAGTTTCAGTGTCTCGAGACACTGAAACTTGTTCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006114.1-1113s1c1
Sequence:CCGGCTTCCTGAATCACCGCAAGAACTCGAGTTCTTGCGGTGATTCAGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006114.1-624s1c1
Sequence:CCGGCCAGCAGTCGAAGTTTGTGAACTCGAGTTCACAAACTTCGACTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006114
VALIDATED
TOMM40 MISSION shRNA Lentiviral Transduction Particles
translocase of outer mitochondrial membrane 40 homolog (yeast)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000231153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_006114.2-913s21c1
Sequence:CCGGACGCAACATACTACCACAAAGCTCGAGCTTTGTGGTAGTATGTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231155    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_006114.2-1362s21c1
Sequence:CCGGTGAATGGCGCTTCGGGATTCTCTCGAGAGAATCCCGAAGCGCCATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_006114.2-419s21c1
Sequence:GTACCGGCAAAGGGTTGAGTAACCATTTCTCGAGAAATGGTTACTCAACCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_006114.2-1138s21c1
Sequence:CCGGATCACCGCAAGAACAAGTTTCCTCGAGGAAACTTGTTCTTGCGGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_006114.2-842s21c1
Sequence:CCGGCATGTCTCTAGCTGGGAAATACTCGAGTATTTCCCAGCTAGAGACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006114.1-894s1c1
Sequence:CCGGGCACGCAACATACTACCACAACTCGAGTTGTGGTAGTATGTTGCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006114.1-390s1c1
Sequence:CCGGGCTCACAGTCAACAAAGGGTTCTCGAGAACCCTTTGTTGACTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006114.1-1126s1c1
Sequence:CCGGCGCAAGAACAAGTTTCAGTGTCTCGAGACACTGAAACTTGTTCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006114.1-1113s1c1
Sequence:CCGGCTTCCTGAATCACCGCAAGAACTCGAGTTCTTGCGGTGATTCAGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006114.1-624s1c1
Sequence:CCGGCCAGCAGTCGAAGTTTGTGAACTCGAGTTCACAAACTTCGACTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks