EMAIL THIS PAGE TO A FRIEND

TOMM40L

translocase of outer mitochondrial membrane 40 homolog (yeast)-like

Synonyms: RP11-297K8.10 TOMM40B
UniProtKB ID: Q969M1, D3DVG9
Gene ID:
Mouse(641376) translocase of outer mitochondrial membrane 40 homolog-like (yeast)
Rat(304971) translocase of outer mitochondrial membrane 40 homolog (yeast)-like
Zebrafish(405895) translocase of outer mitochondrial membrane 40 homolog, like
chicken(426278) translocase of outer mitochondrial membrane 40 homolog (yeast)-like
Horse(100066580) translocase of outer mitochondrial membrane 40 homolog (yeast)-like
domestic cat(101088976) translocase of outer mitochondrial membrane 40 homolog (yeast)-like
dog(609819) translocase of outer mitochondrial membrane 40 homolog (yeast)-like
cow(505393) translocase of outer mitochondrial membrane 40 homolog (yeast)-like
sheep(101105120) translocase of outer mitochondrial membrane 40 homolog (yeast)-like
naked mole-rat(101699629) translocase of outer mitochondrial membrane 40 homolog (yeast)-like
domestic guinea pig(100728126) translocase of outer mitochondrial membrane 40 homolog (yeast)-like
167 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2102509 Anti-TOMM40L antibody produced in rabbit affinity isolated antibody rat, bovine, zebrafish, guinea pig, canine, mouse, horse, rabbit, human
western blot pricing
SAB2104220 Anti-TOMM40L antibody produced in rabbit affinity isolated antibody mouse, bovine, canine, human, rat, zebrafish, guinea pig, horse, rabbit
western blot pricing
HPA051304 Anti-TOMM40L antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032174 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032174 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032174 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001037170 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001037170 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001037170 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU136701 MISSION® esiRNA esiRNA human TOMM40L (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032174 Rosetta Predictions human pricing
NM_001083338 Rosetta Predictions rat pricing
XM_222887 Rosetta Predictions rat pricing
NM_001037170 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032174 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00157091 predicted 1497
2 SASI_Hs01_00157092 predicted 1387
3 SASI_Hs01_00157093 predicted 1102
4 SASI_Hs01_00157094 predicted 1292
5 SASI_Hs01_00157096 predicted 1123
6 SASI_Hs01_00157097 predicted 1396
7 SASI_Hs01_00157098 predicted 883
8 SASI_Hs01_00157099 predicted 680
9 SASI_Hs01_00157100 predicted 931
10 SASI_Hs02_00359445 predicted 397
11 SASI_Hs01_00157095 predicted 1405
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083338 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00208879 predicted 326
2 SASI_Rn02_00208880 predicted 512
3 SASI_Rn02_00208881 predicted 474
4 SASI_Rn02_00208882 predicted 655
5 SASI_Rn02_00208883 predicted 406
6 SASI_Rn02_00208884 predicted 356
7 SASI_Rn02_00208885 predicted 396
8 SASI_Rn02_00208886 predicted 383
9 SASI_Rn02_00208887 predicted 662
10 SASI_Rn02_00208888 predicted 314
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_222887 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00181244 predicted 513
2 SASI_Rn01_00181245 predicted 496
3 SASI_Rn01_00181246 predicted 484
4 SASI_Rn01_00181247 predicted 660
5 SASI_Rn01_00181248 predicted 403
6 SASI_Rn01_00181249 predicted 305
7 SASI_Rn01_00181250 predicted 363
8 SASI_Rn01_00181251 predicted 400
9 SASI_Rn01_00181252 predicted 392
10 SASI_Rn01_00181253 predicted 673
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037170 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00189219 predicted 1243
2 SASI_Mm01_00189220 predicted 756
3 SASI_Mm01_00189223 predicted 1232
4 SASI_Mm01_00189224 predicted 947
5 SASI_Mm01_00189225 predicted 1358
6 SASI_Mm01_00189226 predicted 654
7 SASI_Mm02_00289293 predicted 1141
8 SASI_Mm01_00189227 predicted 723
9 SASI_Mm01_00189228 predicted 1045
10 SASI_Mm02_00289294 predicted 585
11 SASI_Mm01_00189221 predicted 1271
12 SASI_Mm01_00189222 predicted 631
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032174
VALIDATED
TOMM40L MISSION shRNA Bacterial Glycerol Stock
translocase of outer mitochondrial membrane 40 homolog (yeast)-like
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_032174.3-600s1c1
Sequence:CCGGCAAGTTCCTGACATGGCAGTTCTCGAGAACTGCCATGTCAGGAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161965    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032174.3-1003s1c1
Sequence:CCGGGTGGATAGTAACTGGTGTGTACTCGAGTACACACCAGTTACTATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164283    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_032174.3-1692s1c1
Sequence:CCGGCCGCATGAAGAGGCAGTTATTCTCGAGAATAACTGCCTCTTCATGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162430    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032174.3-926s1c1
Sequence:CCGGCAAGGCTACAAGACACAACATCTCGAGATGTTGTGTCTTGTAGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032174.4-993s21c1
Sequence:CCGGCCCAGGCCAACATGGTATTTACTCGAGTAAATACCATGTTGGCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032174.4-670s21c1
Sequence:CCGGAGCCACTCTGACCCTAGGAAACTCGAGTTTCCTAGGGTCAGAGTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032174.4-889s21c1
Sequence:CCGGTTACTACCACAGGGCAAATGACTCGAGTCATTTGCCCTGTGGTAGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032174
VALIDATED
TOMM40L MISSION shRNA shRNA Plasmid DNA
translocase of outer mitochondrial membrane 40 homolog (yeast)-like
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_032174.3-600s1c1
Sequence:CCGGCAAGTTCCTGACATGGCAGTTCTCGAGAACTGCCATGTCAGGAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161965    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032174.3-1003s1c1
Sequence:CCGGGTGGATAGTAACTGGTGTGTACTCGAGTACACACCAGTTACTATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164283    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_032174.3-1692s1c1
Sequence:CCGGCCGCATGAAGAGGCAGTTATTCTCGAGAATAACTGCCTCTTCATGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162430    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032174.3-926s1c1
Sequence:CCGGCAAGGCTACAAGACACAACATCTCGAGATGTTGTGTCTTGTAGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032174.4-993s21c1
Sequence:CCGGCCCAGGCCAACATGGTATTTACTCGAGTAAATACCATGTTGGCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032174.4-670s21c1
Sequence:CCGGAGCCACTCTGACCCTAGGAAACTCGAGTTTCCTAGGGTCAGAGTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032174.4-889s21c1
Sequence:CCGGTTACTACCACAGGGCAAATGACTCGAGTCATTTGCCCTGTGGTAGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032174
VALIDATED
TOMM40L MISSION shRNA Lentiviral Transduction Particles
translocase of outer mitochondrial membrane 40 homolog (yeast)-like
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_032174.3-600s1c1
Sequence:CCGGCAAGTTCCTGACATGGCAGTTCTCGAGAACTGCCATGTCAGGAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161965    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032174.3-1003s1c1
Sequence:CCGGGTGGATAGTAACTGGTGTGTACTCGAGTACACACCAGTTACTATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164283    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_032174.3-1692s1c1
Sequence:CCGGCCGCATGAAGAGGCAGTTATTCTCGAGAATAACTGCCTCTTCATGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162430    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032174.3-926s1c1
Sequence:CCGGCAAGGCTACAAGACACAACATCTCGAGATGTTGTGTCTTGTAGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032174.4-993s21c1
Sequence:CCGGCCCAGGCCAACATGGTATTTACTCGAGTAAATACCATGTTGGCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032174.4-670s21c1
Sequence:CCGGAGCCACTCTGACCCTAGGAAACTCGAGTTTCCTAGGGTCAGAGTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032174.4-889s21c1
Sequence:CCGGTTACTACCACAGGGCAAATGACTCGAGTCATTTGCCCTGTGGTAGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001037170
VALIDATED
TOMM40L MISSION shRNA Bacterial Glycerol Stock
translocase of outer mitochondrial membrane 40 homolog (yeast)-like
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000282149    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001037170.2-1653s21c1
Sequence:CCGGCCTCGGGAAGGGAGGATTAAACTCGAGTTTAATCCTCCCTTCCCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037170.2-970s21c1
Sequence:CCGGGAGTAGAGTTTGAGGCAAATACTCGAGTATTTGCCTCAAACTCTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037170.2-889s21c1
Sequence:CCGGACTGGGTAGCTACGTTGAATGCTCGAGCATTCAACGTAGCTACCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001037170.2-806s21c1
Sequence:CCGGGCTAGGAGGAGAGCTAGTTTACTCGAGTAAACTAGCTCTCCTCCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001037170
VALIDATED
TOMM40L MISSION shRNA shRNA Plasmid DNA
translocase of outer mitochondrial membrane 40 homolog (yeast)-like
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000282149    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001037170.2-1653s21c1
Sequence:CCGGCCTCGGGAAGGGAGGATTAAACTCGAGTTTAATCCTCCCTTCCCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037170.2-970s21c1
Sequence:CCGGGAGTAGAGTTTGAGGCAAATACTCGAGTATTTGCCTCAAACTCTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037170.2-889s21c1
Sequence:CCGGACTGGGTAGCTACGTTGAATGCTCGAGCATTCAACGTAGCTACCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001037170.2-806s21c1
Sequence:CCGGGCTAGGAGGAGAGCTAGTTTACTCGAGTAAACTAGCTCTCCTCCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001037170
VALIDATED
TOMM40L MISSION shRNA Lentiviral Transduction Particles
translocase of outer mitochondrial membrane 40 homolog (yeast)-like
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000282149    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001037170.2-1653s21c1
Sequence:CCGGCCTCGGGAAGGGAGGATTAAACTCGAGTTTAATCCTCCCTTCCCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037170.2-970s21c1
Sequence:CCGGGAGTAGAGTTTGAGGCAAATACTCGAGTATTTGCCTCAAACTCTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037170.2-889s21c1
Sequence:CCGGACTGGGTAGCTACGTTGAATGCTCGAGCATTCAACGTAGCTACCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001037170.2-806s21c1
Sequence:CCGGGCTAGGAGGAGAGCTAGTTTACTCGAGTAAACTAGCTCTCCTCCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks