EMAIL THIS PAGE TO A FRIEND

TOMM5

translocase of outer mitochondrial membrane 5 homolog (yeast)

Synonyms: C9orf105 RP11-263I4.1 Tom5 bA613M10.3
UniProtKB ID: Q8N4H5, B2DG07, F6S928, Q5JRT7
Gene ID:
Mouse(68512) translocase of outer mitochondrial membrane 5 homolog (yeast)
Rat(680080) translocase of outer mitochondrial membrane 5 homolog (yeast)
domestic guinea pig(100713935) translocase of outer mitochondrial membrane 5 homolog (yeast)
naked mole-rat(101705195) translocase of outer mitochondrial membrane 5 homolog (yeast)
cow(615897) translocase of outer mitochondrial membrane 5 homolog (yeast)
sheep(101107412) translocase of outer mitochondrial membrane 5 homolog (yeast)
Zebrafish(497181) translocase of outer mitochondrial membrane 5 homolog (yeast)
domestic cat(101101599) translocase of outer mitochondrial membrane 5 homolog (yeast)
dog(610171) mitochondrial import receptor subunit TOM5 homolog
chicken(426803) translocase of outer mitochondrial membrane 5 homolog (yeast)
79 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA048712 Anti-TOMM5 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001001790 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001790 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001790 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001099675 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001099675 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001099675 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_376833 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_376833 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_376833 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001790 Rosetta Predictions human pricing
XM_933960 Rosetta Predictions human pricing
XM_933963 Rosetta Predictions human pricing
XM_001055588 Rosetta Predictions rat pricing
NM_001099675 Rosetta Predictions mouse pricing
XM_898905 Rosetta Predictions mouse pricing
XM_986679 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001790 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00303933 predicted 258
2 SASI_Hs02_00303934 predicted 463
3 SASI_Hs02_00303935 predicted 309
4 SASI_Hs02_00303936 predicted 492
5 SASI_Hs02_00303937 predicted 468
6 SASI_Hs02_00303938 predicted 303
7 SASI_Hs02_00303939 predicted 491
8 SASI_Hs02_00303940 predicted 500
9 SASI_Hs02_00303941 predicted 273
10 SASI_Hs02_00303942 predicted 477
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933960 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00255238 predicted 533
2 SASI_Hs01_00255239 predicted 564
3 SASI_Hs01_00255240 predicted 550
4 SASI_Hs01_00255241 predicted 564
5 SASI_Hs01_00255242 predicted 493
6 SASI_Hs01_00255243 predicted 557
7 SASI_Hs01_00255244 predicted 556
8 SASI_Hs01_00255245 predicted 539
9 SASI_Hs01_00255246 predicted 513
10 SASI_Hs01_00255247 predicted 507
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933963 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00282936 predicted 274
2 SASI_Hs01_00282937 predicted 462
3 SASI_Hs01_00282938 predicted 434
4 SASI_Hs01_00282939 predicted 474
5 SASI_Hs01_00282940 predicted 456
6 SASI_Hs01_00282941 predicted 469
7 SASI_Hs01_00282942 predicted 235
8 SASI_Hs01_00282943 predicted 446
9 SASI_Hs01_00282944 predicted 415
10 SASI_Hs01_00282945 predicted 417
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055588 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00280182 predicted 621
2 SASI_Rn02_00280183 predicted 222
3 SASI_Rn02_00280184 predicted 625
4 SASI_Rn02_00280185 predicted 495
5 SASI_Rn02_00280186 predicted 173
6 SASI_Rn02_00280187 predicted 537
7 SASI_Rn02_00280188 predicted 464
8 SASI_Rn02_00280189 predicted 19
9 SASI_Rn02_00280190 predicted 504
10 SASI_Rn02_00280191 predicted 548
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099675 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00301975 predicted 371
2 SASI_Mm02_00301976 predicted 319
3 SASI_Mm02_00301977 predicted 355
4 SASI_Mm02_00301978 predicted 323
5 SASI_Mm02_00301979 predicted 304
6 SASI_Mm02_00301980 predicted 309
7 SASI_Mm02_00301981 predicted 308
8 SASI_Mm02_00301982 predicted 268
9 SASI_Mm02_00301983 predicted 240
10 SASI_Mm02_00301984 predicted 381
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898905 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00215240 predicted 417
2 SASI_Mm01_00215241 predicted 360
3 SASI_Mm01_00215242 predicted 411
4 SASI_Mm01_00215243 predicted 371
5 SASI_Mm01_00215244 predicted 356
6 SASI_Mm01_00215245 predicted 352
7 SASI_Mm01_00215246 predicted 350
8 SASI_Mm01_00215247 predicted 311
9 SASI_Mm01_00215248 predicted 233
10 SASI_Mm01_00215249 predicted 290
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_986679 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00267640 predicted 371
2 SASI_Mm01_00267641 predicted 316
3 SASI_Mm01_00267642 predicted 361
4 SASI_Mm01_00267643 predicted 315
5 SASI_Mm01_00267644 predicted 299
6 SASI_Mm01_00267645 predicted 306
7 SASI_Mm01_00267646 predicted 305
8 SASI_Mm01_00267647 predicted 264
9 SASI_Mm01_00267648 predicted 235
10 SASI_Mm01_00267649 predicted 372
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001790
VALIDATED
TOMM5 MISSION shRNA Bacterial Glycerol Stock
translocase of outer mitochondrial membrane 5 homolog (yeast)
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000443905    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001790.2-302s21c1
Sequence:CCGGCTGGTTACAGTTTCGACTCCTCTCGAGAGGAGTCGAAACTGTAACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437988    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001790.2-493s21c1
Sequence:CCGGGACGTTTGGCCTCTGACAATACTCGAGTATTGTCAGAGGCCAAACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415606    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001790.2-504s21c1
Sequence:CCGGTCTGACAATACTGGTATAATTCTCGAGAATTATACCAGTATTGTCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425546    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001790.2-480s21c1
Sequence:CCGGCCCTTATCCCTGTGACGTTTGCTCGAGCAAACGTCACAGGGATAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429182    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001790.2-558s21c1
Sequence:CCGGATTAAGGGAGCTGTGTCTGAACTCGAGTTCAGACACAGCTCCCTTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437361    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001790.2-395s21c1
Sequence:CCGGCAAGTTTGGCTCTGGTAACTGCTCGAGCAGTTACCAGAGCCAAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143514    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001790.1-514s1c1
Sequence:CCGGGCACTGTCTTGTCAGTCATTTCTCGAGAAATGACTGACAAGACAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142982    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001790.1-119s1c1
Sequence:CCGGCCATACGGAACTTTCTCATCTCTCGAGAGATGAGAAAGTTCCGTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142024    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001001790.1-248s1c1
Sequence:CCGGGACTCCTCTCTGCAAGTGAATCTCGAGATTCACTTGCAGAGAGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141612    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001001790.1-219s1c1
Sequence:CCGGCACGATATGAAGAGCCTGGTTCTCGAGAACCAGGCTCTTCATATCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145022    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001790.1-287s1c1
Sequence:CCGGGAGACTCTTTGAATGGACATACTCGAGTATGTCCATTCAAAGAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144648    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001001790.1-276s1c1
Sequence:CCGGGAAAGGTGTAAGAGACTCTTTCTCGAGAAAGAGTCTCTTACACCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144507    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001790.1-154s1c1
Sequence:CCGGCGAGTCACTCCATTTATCTTACTCGAGTAAGATAAATGGAGTGACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001790
VALIDATED
TOMM5 MISSION shRNA shRNA Plasmid DNA
translocase of outer mitochondrial membrane 5 homolog (yeast)
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000443905    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001790.2-302s21c1
Sequence:CCGGCTGGTTACAGTTTCGACTCCTCTCGAGAGGAGTCGAAACTGTAACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437988    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001790.2-493s21c1
Sequence:CCGGGACGTTTGGCCTCTGACAATACTCGAGTATTGTCAGAGGCCAAACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415606    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001790.2-504s21c1
Sequence:CCGGTCTGACAATACTGGTATAATTCTCGAGAATTATACCAGTATTGTCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425546    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001790.2-480s21c1
Sequence:CCGGCCCTTATCCCTGTGACGTTTGCTCGAGCAAACGTCACAGGGATAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429182    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001790.2-558s21c1
Sequence:CCGGATTAAGGGAGCTGTGTCTGAACTCGAGTTCAGACACAGCTCCCTTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437361    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001790.2-395s21c1
Sequence:CCGGCAAGTTTGGCTCTGGTAACTGCTCGAGCAGTTACCAGAGCCAAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143514    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001790.1-514s1c1
Sequence:CCGGGCACTGTCTTGTCAGTCATTTCTCGAGAAATGACTGACAAGACAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142982    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001790.1-119s1c1
Sequence:CCGGCCATACGGAACTTTCTCATCTCTCGAGAGATGAGAAAGTTCCGTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142024    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001001790.1-248s1c1
Sequence:CCGGGACTCCTCTCTGCAAGTGAATCTCGAGATTCACTTGCAGAGAGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141612    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001001790.1-219s1c1
Sequence:CCGGCACGATATGAAGAGCCTGGTTCTCGAGAACCAGGCTCTTCATATCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145022    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001790.1-287s1c1
Sequence:CCGGGAGACTCTTTGAATGGACATACTCGAGTATGTCCATTCAAAGAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144648    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001001790.1-276s1c1
Sequence:CCGGGAAAGGTGTAAGAGACTCTTTCTCGAGAAAGAGTCTCTTACACCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144507    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001790.1-154s1c1
Sequence:CCGGCGAGTCACTCCATTTATCTTACTCGAGTAAGATAAATGGAGTGACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001790
VALIDATED
TOMM5 MISSION shRNA Lentiviral Transduction Particles
translocase of outer mitochondrial membrane 5 homolog (yeast)
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000443905    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001790.2-302s21c1
Sequence:CCGGCTGGTTACAGTTTCGACTCCTCTCGAGAGGAGTCGAAACTGTAACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437988    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001790.2-493s21c1
Sequence:CCGGGACGTTTGGCCTCTGACAATACTCGAGTATTGTCAGAGGCCAAACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415606    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001790.2-504s21c1
Sequence:CCGGTCTGACAATACTGGTATAATTCTCGAGAATTATACCAGTATTGTCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425546    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001790.2-480s21c1
Sequence:CCGGCCCTTATCCCTGTGACGTTTGCTCGAGCAAACGTCACAGGGATAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429182    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001790.2-558s21c1
Sequence:CCGGATTAAGGGAGCTGTGTCTGAACTCGAGTTCAGACACAGCTCCCTTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437361    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001790.2-395s21c1
Sequence:CCGGCAAGTTTGGCTCTGGTAACTGCTCGAGCAGTTACCAGAGCCAAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143514    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001790.1-514s1c1
Sequence:CCGGGCACTGTCTTGTCAGTCATTTCTCGAGAAATGACTGACAAGACAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142982    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001790.1-119s1c1
Sequence:CCGGCCATACGGAACTTTCTCATCTCTCGAGAGATGAGAAAGTTCCGTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142024    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001001790.1-248s1c1
Sequence:CCGGGACTCCTCTCTGCAAGTGAATCTCGAGATTCACTTGCAGAGAGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141612    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001001790.1-219s1c1
Sequence:CCGGCACGATATGAAGAGCCTGGTTCTCGAGAACCAGGCTCTTCATATCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145022    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001790.1-287s1c1
Sequence:CCGGGAGACTCTTTGAATGGACATACTCGAGTATGTCCATTCAAAGAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144648    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001001790.1-276s1c1
Sequence:CCGGGAAAGGTGTAAGAGACTCTTTCTCGAGAAAGAGTCTCTTACACCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144507    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001790.1-154s1c1
Sequence:CCGGCGAGTCACTCCATTTATCTTACTCGAGTAAGATAAATGGAGTGACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001099675
VALIDATED
TOMM5 MISSION shRNA Bacterial Glycerol Stock
translocase of outer mitochondrial membrane 5 homolog (yeast)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253564    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001099675.1-326s21c1
Sequence:CCGGGCTGATTAAACGGACATATAACTCGAGTTATATGTCCGTTTAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001099675.1-213s21c1
Sequence:CCGGTTAAAGAAGCTGGATAGCATCCTCGAGGATGCTATCCAGCTTCTTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001099675.1-191s21c1
Sequence:CCGGGCTGCGAGTCACTCCATATATCTCGAGATATATGGAGTGACTCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001099675.1-152s21c1
Sequence:CCGGGGTCTCCTCCATTCGGAACTTCTCGAGAAGTTCCGAATGGAGGAGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001099675.1-119s21c1
Sequence:CCGGGGAGGAGATGAAGCGGAAGATCTCGAGATCTTCCGCTTCATCTCCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001099675
VALIDATED
TOMM5 MISSION shRNA shRNA Plasmid DNA
translocase of outer mitochondrial membrane 5 homolog (yeast)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253564    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001099675.1-326s21c1
Sequence:CCGGGCTGATTAAACGGACATATAACTCGAGTTATATGTCCGTTTAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001099675.1-213s21c1
Sequence:CCGGTTAAAGAAGCTGGATAGCATCCTCGAGGATGCTATCCAGCTTCTTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001099675.1-191s21c1
Sequence:CCGGGCTGCGAGTCACTCCATATATCTCGAGATATATGGAGTGACTCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001099675.1-152s21c1
Sequence:CCGGGGTCTCCTCCATTCGGAACTTCTCGAGAAGTTCCGAATGGAGGAGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001099675.1-119s21c1
Sequence:CCGGGGAGGAGATGAAGCGGAAGATCTCGAGATCTTCCGCTTCATCTCCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001099675
VALIDATED
TOMM5 MISSION shRNA Lentiviral Transduction Particles
translocase of outer mitochondrial membrane 5 homolog (yeast)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253564    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001099675.1-326s21c1
Sequence:CCGGGCTGATTAAACGGACATATAACTCGAGTTATATGTCCGTTTAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001099675.1-213s21c1
Sequence:CCGGTTAAAGAAGCTGGATAGCATCCTCGAGGATGCTATCCAGCTTCTTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001099675.1-191s21c1
Sequence:CCGGGCTGCGAGTCACTCCATATATCTCGAGATATATGGAGTGACTCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001099675.1-152s21c1
Sequence:CCGGGGTCTCCTCCATTCGGAACTTCTCGAGAAGTTCCGAATGGAGGAGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001099675.1-119s21c1
Sequence:CCGGGGAGGAGATGAAGCGGAAGATCTCGAGATCTTCCGCTTCATCTCCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_376833
TOMM5 MISSION shRNA Bacterial Glycerol Stock
translocase of outer mitochondrial membrane 5 homolog (yeast)
Human
1 Products Total
TRC Number Price Set Price (1)? Select
TRCN0000121537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376833.1-138s1c1
Sequence:CCGGCATACGGAACTTTCTCATCTACTCGAGTAGATGAGAAAGTTCCGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_376833
TOMM5 MISSION shRNA shRNA Plasmid DNA
translocase of outer mitochondrial membrane 5 homolog (yeast)
Human
1 Products Total
TRC Number Vector Price Set Price (1)? Select
TRCN0000121537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376833.1-138s1c1
Sequence:CCGGCATACGGAACTTTCTCATCTACTCGAGTAGATGAGAAAGTTCCGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_376833
TOMM5 MISSION shRNA Lentiviral Transduction Particles
translocase of outer mitochondrial membrane 5 homolog (yeast)
Human
1 Products Total
TRC Number Volume Titer Vector Price Set Price (1)? Select
TRCN0000121537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376833.1-138s1c1
Sequence:CCGGCATACGGAACTTTCTCATCTACTCGAGTAGATGAGAAAGTTCCGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks