EMAIL THIS PAGE TO A FRIEND

TOMM6

translocase of outer mitochondrial membrane 6 homolog (yeast)

Synonyms: OBTP
UniProtKB ID: Q96B49, B2DG15, Q9UH52
Gene ID:
Mouse(66119) translocase of outer mitochondrial membrane 6 homolog (yeast)
Rat(681123) translocase of outer mitochondrial membrane 6 homolog (yeast)
chicken(419924) translocase of outer mitochondrial membrane 6 homolog (yeast)
dog(609079) translocase of outer mitochondrial membrane 6 homolog (yeast)
domestic cat(101100563) translocase of outer mitochondrial membrane 6 homolog (yeast)
cow(505031) translocase of outer mitochondrial membrane 6 homolog (yeast)
sheep(101107142) translocase of outer mitochondrial membrane 6 homolog (yeast)
naked mole-rat(101710551) translocase of outer mitochondrial membrane 6 homolog (yeast)
Domestic Rabbit(100328716) translocase of outer mitochondrial membrane 6 homolog (yeast)
domestic guinea pig(100716279) translocase of outer mitochondrial membrane 6 homolog (yeast)
111 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025365 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025365 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025365 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001134493 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001134493 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001134493 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU230341 MISSION® esiRNA esiRNA targeting human TOMM6 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001060392 Rosetta Predictions rat pricing
NM_025365 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060392 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00296354 predicted 508
2 SASI_Rn02_00296355 predicted 463
3 SASI_Rn02_00296356 predicted 371
4 SASI_Rn02_00296357 predicted 354
5 SASI_Rn02_00296358 predicted 349
6 SASI_Rn02_00296359 predicted 490
7 SASI_Rn02_00296360 predicted 360
8 SASI_Rn02_00296361 predicted 422
9 SASI_Rn02_00296362 predicted 271
10 SASI_Rn02_00296363 predicted 350
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025365 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00044793 predicted 613
2 SASI_Mm01_00044795 predicted 646
3 SASI_Mm01_00044796 predicted 485
4 SASI_Mm01_00044797 predicted 424
5 SASI_Mm01_00044798 predicted 474
6 SASI_Mm01_00044799 predicted 472
7 SASI_Mm01_00044800 predicted 513
8 SASI_Mm01_00044801 predicted 444
9 SASI_Mm01_00044802 predicted 657
10 SASI_Mm02_00328078 predicted 649
11 SASI_Mm01_00044794 predicted 501
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025365
TOMM6 MISSION shRNA Bacterial Glycerol Stock
translocase of outer mitochondrial membrane 6 homolog (yeast)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201978    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025365.2-541s1c1
Sequence:CCGGCCAGGAACTTGAGTGACATTGCTCGAGCAATGTCACTCAAGTTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192940    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025365.2-615s1c1
Sequence:CCGGGCCTATTTCAGGAATCCTAAACTCGAGTTTAGGATTCCTGAAATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190492    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025365.2-667s1c1
Sequence:CCGGGTCACAGAAGTAGGGAAGATTCTCGAGAATCTTCCCTACTTCTGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240971    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025365.2-668s21c1
Sequence:CCGGTCACAGAAGTAGGGAAGATTCCTCGAGGAATCTTCCCTACTTCTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240970    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025365.2-615s21c1
Sequence:CCGGGCCTATTTCAGGAATCCTAAACTCGAGTTTAGGATTCCTGAAATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240974    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025365.2-694s21c1
Sequence:CCGGGTAAAGCCTTGCCCTTGTGTTCTCGAGAACACAAGGGCAAGGCTTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240973    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025365.2-657s21c1
Sequence:CCGGCTGTCAGCTAGTCACAGAAGTCTCGAGACTTCTGTGACTAGCTGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025365.2-590s21c1
Sequence:CCGGGCCAGGTAAGACTTCACTTTCCTCGAGGAAAGTGAAGTCTTACCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025365
TOMM6 MISSION shRNA shRNA Plasmid DNA
translocase of outer mitochondrial membrane 6 homolog (yeast)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201978    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025365.2-541s1c1
Sequence:CCGGCCAGGAACTTGAGTGACATTGCTCGAGCAATGTCACTCAAGTTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192940    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025365.2-615s1c1
Sequence:CCGGGCCTATTTCAGGAATCCTAAACTCGAGTTTAGGATTCCTGAAATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190492    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025365.2-667s1c1
Sequence:CCGGGTCACAGAAGTAGGGAAGATTCTCGAGAATCTTCCCTACTTCTGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240971    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025365.2-668s21c1
Sequence:CCGGTCACAGAAGTAGGGAAGATTCCTCGAGGAATCTTCCCTACTTCTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240970    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025365.2-615s21c1
Sequence:CCGGGCCTATTTCAGGAATCCTAAACTCGAGTTTAGGATTCCTGAAATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240974    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025365.2-694s21c1
Sequence:CCGGGTAAAGCCTTGCCCTTGTGTTCTCGAGAACACAAGGGCAAGGCTTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240973    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025365.2-657s21c1
Sequence:CCGGCTGTCAGCTAGTCACAGAAGTCTCGAGACTTCTGTGACTAGCTGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025365.2-590s21c1
Sequence:CCGGGCCAGGTAAGACTTCACTTTCCTCGAGGAAAGTGAAGTCTTACCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025365
TOMM6 MISSION shRNA Lentiviral Transduction Particles
translocase of outer mitochondrial membrane 6 homolog (yeast)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201978    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025365.2-541s1c1
Sequence:CCGGCCAGGAACTTGAGTGACATTGCTCGAGCAATGTCACTCAAGTTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192940    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025365.2-615s1c1
Sequence:CCGGGCCTATTTCAGGAATCCTAAACTCGAGTTTAGGATTCCTGAAATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190492    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025365.2-667s1c1
Sequence:CCGGGTCACAGAAGTAGGGAAGATTCTCGAGAATCTTCCCTACTTCTGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240971    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025365.2-668s21c1
Sequence:CCGGTCACAGAAGTAGGGAAGATTCCTCGAGGAATCTTCCCTACTTCTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240970    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025365.2-615s21c1
Sequence:CCGGGCCTATTTCAGGAATCCTAAACTCGAGTTTAGGATTCCTGAAATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240974    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025365.2-694s21c1
Sequence:CCGGGTAAAGCCTTGCCCTTGTGTTCTCGAGAACACAAGGGCAAGGCTTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240973    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025365.2-657s21c1
Sequence:CCGGCTGTCAGCTAGTCACAGAAGTCTCGAGACTTCTGTGACTAGCTGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025365.2-590s21c1
Sequence:CCGGGCCAGGTAAGACTTCACTTTCCTCGAGGAAAGTGAAGTCTTACCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001134493
VALIDATED
TOMM6 MISSION shRNA Bacterial Glycerol Stock
translocase of outer mitochondrial membrane 6 homolog (yeast)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000344468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_001134493.1-405s21c1
Sequence:CCGGACTCTTTGCTGCGGGAGTTTGCTCGAGCAAACTCCCGCAGCAAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_001134493.1-352s21c1
Sequence:CCGGCGCTTTGCCACTGATAGGAATCTCGAGATTCCTATCAGTGGCAAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344404    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_001134493.1-492s21c1
Sequence:CCGGTAATGCCACCTGTCGTCTTATCTCGAGATAAGACGACAGGTGGCATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_001134493.1-295s21c1
Sequence:CCGGGCTAATGAAACTCCCGAAATACTCGAGTATTTCGGGAGTTTCATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_001134493.1-378s21c1
Sequence:CCGGCCGGAGGAACTTGATACTAAACTCGAGTTTAGTATCAAGTTCCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001134493
VALIDATED
TOMM6 MISSION shRNA shRNA Plasmid DNA
translocase of outer mitochondrial membrane 6 homolog (yeast)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000344468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_001134493.1-405s21c1
Sequence:CCGGACTCTTTGCTGCGGGAGTTTGCTCGAGCAAACTCCCGCAGCAAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_001134493.1-352s21c1
Sequence:CCGGCGCTTTGCCACTGATAGGAATCTCGAGATTCCTATCAGTGGCAAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344404    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_001134493.1-492s21c1
Sequence:CCGGTAATGCCACCTGTCGTCTTATCTCGAGATAAGACGACAGGTGGCATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_001134493.1-295s21c1
Sequence:CCGGGCTAATGAAACTCCCGAAATACTCGAGTATTTCGGGAGTTTCATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_001134493.1-378s21c1
Sequence:CCGGCCGGAGGAACTTGATACTAAACTCGAGTTTAGTATCAAGTTCCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001134493
VALIDATED
TOMM6 MISSION shRNA Lentiviral Transduction Particles
translocase of outer mitochondrial membrane 6 homolog (yeast)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000344468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_001134493.1-405s21c1
Sequence:CCGGACTCTTTGCTGCGGGAGTTTGCTCGAGCAAACTCCCGCAGCAAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_001134493.1-352s21c1
Sequence:CCGGCGCTTTGCCACTGATAGGAATCTCGAGATTCCTATCAGTGGCAAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344404    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_001134493.1-492s21c1
Sequence:CCGGTAATGCCACCTGTCGTCTTATCTCGAGATAAGACGACAGGTGGCATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_001134493.1-295s21c1
Sequence:CCGGGCTAATGAAACTCCCGAAATACTCGAGTATTTCGGGAGTTTCATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_001134493.1-378s21c1
Sequence:CCGGCCGGAGGAACTTGATACTAAACTCGAGTTTAGTATCAAGTTCCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks