EMAIL THIS PAGE TO A FRIEND

TOMM70A

translocase of outer mitochondrial membrane 70 homolog A (S. cerevisiae)

UniProtKB ID: O94826, D3DN48
Gene ID:
Human(9868) Summary: This gene encodes an import receptor of the outer mitochondrial membrane that is part of the translocase of the outer membrane complex. This protein is involved in the import of mitochondrial precursor proteins. [provided by RefSeq, Oct 2011]
Mouse(28185) translocase of outer mitochondrial membrane 70 homolog A (yeast)
Rat(304017) translocase of outer mitochondrial membrane 70 homolog A (S. cerevisiae)
Zebrafish(572969) translocase of outer mitochondrial membrane 70 homolog A (yeast)
chicken(418387) translocase of outer mitochondrial membrane 70 homolog A (S. cerevisiae)
domestic cat(101093292) translocase of outer mitochondrial membrane 70 homolog A (S. cerevisiae)
dog(478541) translocase of outer mitochondrial membrane 70 homolog A (S. cerevisiae)
cow(507707) translocase of outer mitochondrial membrane 70 homolog A (S. cerevisiae)
sheep(101109499) translocase of outer mitochondrial membrane 70 homolog A (S. cerevisiae)
naked mole-rat(101714783) translocase of outer mitochondrial membrane 70 homolog A (S. cerevisiae)
Domestic Rabbit(100352274) translocase of outer mitochondrial membrane 70 homolog A (S. cerevisiae)
domestic guinea pig(100724193) translocase of outer mitochondrial membrane 70 homolog A (S. cerevisiae)
110 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014820 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014820 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014820 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_138599 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_138599 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_138599 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014820 Rosetta Predictions human pricing
NM_212519 Rosetta Predictions rat pricing
NM_138599 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014820 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00184261 predicted 1032
2 SASI_Hs01_00184263 predicted 1869
3 SASI_Hs01_00184264 predicted 2217
4 SASI_Hs01_00184265 predicted 1780
5 SASI_Hs01_00184267 predicted 2017
6 SASI_Hs01_00184269 predicted 1434
7 SASI_Hs01_00184270 predicted 1012
8 SASI_Hs02_00346354 predicted 752
9 SASI_Hs02_00346355 predicted 2007
10 SASI_Hs02_00346356 predicted 820
11 SASI_Hs01_00184262 predicted 2126
12 SASI_Hs01_00184266 predicted 1479
13 SASI_Hs01_00184268 predicted 1968
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212519 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00088873 predicted 544
2 SASI_Rn01_00088874 predicted 823
3 SASI_Rn01_00088875 predicted 1620
4 SASI_Rn01_00088876 predicted 744
5 SASI_Rn01_00088877 predicted 1924
6 SASI_Rn01_00088879 predicted 1663
7 SASI_Rn01_00088881 predicted 1677
8 SASI_Rn01_00088882 predicted 1432
9 SASI_Rn02_00270532 predicted 579
10 SASI_Rn02_00270533 predicted 729
11 SASI_Rn01_00088878 predicted 1320
12 SASI_Rn01_00088880 predicted 539
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138599 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00169127 predicted 1738
2 SASI_Mm01_00169128 predicted 1216
3 SASI_Mm01_00169129 predicted 1437
4 SASI_Mm01_00169130 predicted 768
5 SASI_Mm01_00169131 predicted 759
6 SASI_Mm02_00339668 predicted 1937
7 SASI_Mm01_00169132 predicted 1683
8 SASI_Mm01_00169133 predicted 790
9 SASI_Mm01_00169134 predicted 1872
10 SASI_Mm01_00169135 predicted 549
11 SASI_Mm01_00169136 predicted 752
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014820
VALIDATED
TOMM70A MISSION shRNA Bacterial Glycerol Stock
translocase of outer mitochondrial membrane 70 homolog A (S. cerevisiae)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000157550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014820.2-1626s1c1
Sequence:CCGGGCTGACATCGATCCTCAGAATCTCGAGATTCTGAGGATCGATGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014820.2-927s1c1
Sequence:CCGGGCTGCCTTTGAACAGTTGCAACTCGAGTTGCAACTGTTCAAAGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014820.2-1538s1c1
Sequence:CCGGGCTTCGAGCAAATGCTCTCATCTCGAGATGAGAGCATTTGCTCGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155588    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014820.2-849s1c1
Sequence:CCGGCAGTGCTATACTGAGGCTATTCTCGAGAATAGCCTCAGTATAGCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014820.2-1485s1c1
Sequence:CCGGGCAGCCAAACCAGATTTAGATCTCGAGATCTAAATCTGGTTTGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014820.2-1452s1c1
Sequence:CCGGGCTACCTTCTACCTGCTTATTCTCGAGAATAAGCAGGTAGAAGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_014820.3-1951s21c1
Sequence:GTACCGGCCAGATAATGCTACAACATATCTCGAGATATGTTGTAGCATTATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230036    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014820.3-3103s21c1
Sequence:CCGGTGGCACTGTATATACTATTTACTCGAGTAAATAGTATATACAGTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_014820.3-1872s21c1
Sequence:CCGGACTATACGCCCAGGCATTAACCTCGAGGTTAATGCCTGGGCGTATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_014820.3-837s21c1
Sequence:CCGGGTGCTATACTGAGGCTATTAGCTCGAGCTAATAGCCTCAGTATAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_014820.3-1103s21c1
Sequence:CCGGGCATGCTGTTAGCCGATAAAGCTCGAGCTTTATCGGCTAACAGCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014820
VALIDATED
TOMM70A MISSION shRNA shRNA Plasmid DNA
translocase of outer mitochondrial membrane 70 homolog A (S. cerevisiae)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000157550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014820.2-1626s1c1
Sequence:CCGGGCTGACATCGATCCTCAGAATCTCGAGATTCTGAGGATCGATGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014820.2-927s1c1
Sequence:CCGGGCTGCCTTTGAACAGTTGCAACTCGAGTTGCAACTGTTCAAAGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014820.2-1538s1c1
Sequence:CCGGGCTTCGAGCAAATGCTCTCATCTCGAGATGAGAGCATTTGCTCGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155588    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014820.2-849s1c1
Sequence:CCGGCAGTGCTATACTGAGGCTATTCTCGAGAATAGCCTCAGTATAGCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014820.2-1485s1c1
Sequence:CCGGGCAGCCAAACCAGATTTAGATCTCGAGATCTAAATCTGGTTTGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014820.2-1452s1c1
Sequence:CCGGGCTACCTTCTACCTGCTTATTCTCGAGAATAAGCAGGTAGAAGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_014820.3-1951s21c1
Sequence:GTACCGGCCAGATAATGCTACAACATATCTCGAGATATGTTGTAGCATTATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230036    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014820.3-3103s21c1
Sequence:CCGGTGGCACTGTATATACTATTTACTCGAGTAAATAGTATATACAGTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_014820.3-1872s21c1
Sequence:CCGGACTATACGCCCAGGCATTAACCTCGAGGTTAATGCCTGGGCGTATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_014820.3-837s21c1
Sequence:CCGGGTGCTATACTGAGGCTATTAGCTCGAGCTAATAGCCTCAGTATAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_014820.3-1103s21c1
Sequence:CCGGGCATGCTGTTAGCCGATAAAGCTCGAGCTTTATCGGCTAACAGCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014820
VALIDATED
TOMM70A MISSION shRNA Lentiviral Transduction Particles
translocase of outer mitochondrial membrane 70 homolog A (S. cerevisiae)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000157550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014820.2-1626s1c1
Sequence:CCGGGCTGACATCGATCCTCAGAATCTCGAGATTCTGAGGATCGATGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014820.2-927s1c1
Sequence:CCGGGCTGCCTTTGAACAGTTGCAACTCGAGTTGCAACTGTTCAAAGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014820.2-1538s1c1
Sequence:CCGGGCTTCGAGCAAATGCTCTCATCTCGAGATGAGAGCATTTGCTCGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155588    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014820.2-849s1c1
Sequence:CCGGCAGTGCTATACTGAGGCTATTCTCGAGAATAGCCTCAGTATAGCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014820.2-1485s1c1
Sequence:CCGGGCAGCCAAACCAGATTTAGATCTCGAGATCTAAATCTGGTTTGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014820.2-1452s1c1
Sequence:CCGGGCTACCTTCTACCTGCTTATTCTCGAGAATAAGCAGGTAGAAGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_014820.3-1951s21c1
Sequence:GTACCGGCCAGATAATGCTACAACATATCTCGAGATATGTTGTAGCATTATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230036    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014820.3-3103s21c1
Sequence:CCGGTGGCACTGTATATACTATTTACTCGAGTAAATAGTATATACAGTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_014820.3-1872s21c1
Sequence:CCGGACTATACGCCCAGGCATTAACCTCGAGGTTAATGCCTGGGCGTATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_014820.3-837s21c1
Sequence:CCGGGTGCTATACTGAGGCTATTAGCTCGAGCTAATAGCCTCAGTATAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_014820.3-1103s21c1
Sequence:CCGGGCATGCTGTTAGCCGATAAAGCTCGAGCTTTATCGGCTAACAGCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138599
VALIDATED
TOMM70A MISSION shRNA Bacterial Glycerol Stock
translocase of outer mitochondrial membrane 70 homolog A (S. cerevisiae)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000077167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138599.2-1205s1c1
Sequence:CCGGGCCTGACTTAGATAAGGTCATCTCGAGATGACCTTATCTAAGTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077163    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138599.2-2524s1c1
Sequence:CCGGCCTCTGATTCTGTAGAACTTTCTCGAGAAAGTTCTACAGAATCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138599.2-1605s1c1
Sequence:CCGGGCCCAGGCATTAACAGATCAACTCGAGTTGATCTGTTAATGCCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138599.2-694s1c1
Sequence:CCGGCTGTTGAACTTAATCCCAAATCTCGAGATTTGGGATTAAGTTCAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138599.2-693s1c1
Sequence:CCGGGCTGTTGAACTTAATCCCAAACTCGAGTTTGGGATTAAGTTCAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138599.5-1349s21c1
Sequence:CCGGCCTATGAACTCAGACGTTTATCTCGAGATAAACGTCTGAGTTCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138599.5-1948s21c1
Sequence:CCGGAGCAAAGAAATACGGATTAAACTCGAGTTTAATCCGTATTTCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138599.5-693s21c1
Sequence:CCGGCTGTTGAACTTAATCCCAAATCTCGAGATTTGGGATTAAGTTCAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138599.5-1604s21c1
Sequence:CCGGGCCCAGGCATTAACAGATCAACTCGAGTTGATCTGTTAATGCCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319639    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138599.5-2203s21c1
Sequence:CCGGACCTGTTAAAGGGATATTAAACTCGAGTTTAATATCCCTTTAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138599
VALIDATED
TOMM70A MISSION shRNA shRNA Plasmid DNA
translocase of outer mitochondrial membrane 70 homolog A (S. cerevisiae)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000077167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138599.2-1205s1c1
Sequence:CCGGGCCTGACTTAGATAAGGTCATCTCGAGATGACCTTATCTAAGTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077163    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138599.2-2524s1c1
Sequence:CCGGCCTCTGATTCTGTAGAACTTTCTCGAGAAAGTTCTACAGAATCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138599.2-1605s1c1
Sequence:CCGGGCCCAGGCATTAACAGATCAACTCGAGTTGATCTGTTAATGCCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138599.2-694s1c1
Sequence:CCGGCTGTTGAACTTAATCCCAAATCTCGAGATTTGGGATTAAGTTCAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138599.2-693s1c1
Sequence:CCGGGCTGTTGAACTTAATCCCAAACTCGAGTTTGGGATTAAGTTCAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138599.5-1349s21c1
Sequence:CCGGCCTATGAACTCAGACGTTTATCTCGAGATAAACGTCTGAGTTCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138599.5-1948s21c1
Sequence:CCGGAGCAAAGAAATACGGATTAAACTCGAGTTTAATCCGTATTTCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138599.5-693s21c1
Sequence:CCGGCTGTTGAACTTAATCCCAAATCTCGAGATTTGGGATTAAGTTCAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138599.5-1604s21c1
Sequence:CCGGGCCCAGGCATTAACAGATCAACTCGAGTTGATCTGTTAATGCCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319639    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138599.5-2203s21c1
Sequence:CCGGACCTGTTAAAGGGATATTAAACTCGAGTTTAATATCCCTTTAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138599
VALIDATED
TOMM70A MISSION shRNA Lentiviral Transduction Particles
translocase of outer mitochondrial membrane 70 homolog A (S. cerevisiae)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000077167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138599.2-1205s1c1
Sequence:CCGGGCCTGACTTAGATAAGGTCATCTCGAGATGACCTTATCTAAGTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077163    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138599.2-2524s1c1
Sequence:CCGGCCTCTGATTCTGTAGAACTTTCTCGAGAAAGTTCTACAGAATCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138599.2-1605s1c1
Sequence:CCGGGCCCAGGCATTAACAGATCAACTCGAGTTGATCTGTTAATGCCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138599.2-694s1c1
Sequence:CCGGCTGTTGAACTTAATCCCAAATCTCGAGATTTGGGATTAAGTTCAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138599.2-693s1c1
Sequence:CCGGGCTGTTGAACTTAATCCCAAACTCGAGTTTGGGATTAAGTTCAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138599.5-1349s21c1
Sequence:CCGGCCTATGAACTCAGACGTTTATCTCGAGATAAACGTCTGAGTTCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138599.5-1948s21c1
Sequence:CCGGAGCAAAGAAATACGGATTAAACTCGAGTTTAATCCGTATTTCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138599.5-693s21c1
Sequence:CCGGCTGTTGAACTTAATCCCAAATCTCGAGATTTGGGATTAAGTTCAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138599.5-1604s21c1
Sequence:CCGGGCCCAGGCATTAACAGATCAACTCGAGTTGATCTGTTAATGCCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319639    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138599.5-2203s21c1
Sequence:CCGGACCTGTTAAAGGGATATTAAACTCGAGTTTAATATCCCTTTAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks