EMAIL THIS PAGE TO A FRIEND

TOMM7

translocase of outer mitochondrial membrane 7 homolog (yeast)

Synonyms: TOM7
UniProtKB ID: Q9P0U1, O95939
Gene ID:
Human(54543) Summary: This gene encodes a subunit of the translocase of the outer mitochondrial membrane. The encoded protein regulates the assembly and stability of the translocase complex. [provided by RefSeq, Oct 2012]
Mouse(66169) translocase of outer mitochondrial membrane 7 homolog (yeast)
Rat(685620) translocase of outer mitochondrial membrane 7 homolog (yeast)
domestic guinea pig(100714569) translocase of outer mitochondrial membrane 7 homolog (yeast)
naked mole-rat(101699993) translocase of outer mitochondrial membrane 7 homolog (yeast)
cow(614074) translocase of outer mitochondrial membrane 7 homolog (yeast)
sheep(101108566) translocase of outer mitochondrial membrane 7 homolog (yeast)
Zebrafish(751649) translocase of outer mitochondrial membrane 7 homolog (yeast)
chicken(420610) translocase of outer mitochondrial membrane 7 homolog (yeast)
dog(482351) translocase of outer mitochondrial membrane 7 homolog (yeast)
67 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019059 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019059 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019059 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025394 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025394 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025394 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019059 Rosetta Predictions human pricing
XM_001064547 Rosetta Predictions rat pricing
NM_025394 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019059 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00352645 predicted 214
2 SASI_Hs01_00020681 predicted 245
3 SASI_Hs01_00020682 predicted 263
4 SASI_Hs01_00020683 predicted 250
5 SASI_Hs01_00020684 predicted 227
6 SASI_Hs01_00020685 predicted 264
7 SASI_Hs01_00020686 predicted 235
8 SASI_Hs02_00352646 predicted 200
9 SASI_Hs01_00020687 predicted 237
10 SASI_Hs01_00020688 predicted 215
11 SASI_Hs01_00020689 predicted 277
12 SASI_Hs01_00020690 predicted 266
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064547 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00310949 predicted 332
2 SASI_Rn02_00310950 predicted 331
3 SASI_Rn02_00310951 predicted 121
4 SASI_Rn02_00310952 predicted 123
5 SASI_Rn02_00310953 predicted 330
6 SASI_Rn02_00310954 predicted 295
7 SASI_Rn02_00310955 predicted 322
8 SASI_Rn02_00310956 predicted 100
9 SASI_Rn02_00310957 predicted 215
10 SASI_Rn02_00310958 predicted 261
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025394 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00096060 predicted 350
2 SASI_Mm02_00328139 predicted 485
3 SASI_Mm01_00096062 predicted 251
4 SASI_Mm02_00328140 predicted 586
5 SASI_Mm02_00328141 predicted 494
6 SASI_Mm02_00328142 predicted 484
7 SASI_Mm01_00096064 predicted 351
8 SASI_Mm01_00096066 predicted 337
9 SASI_Mm02_00328143 predicted 573
10 SASI_Mm02_00328144 predicted 441
11 SASI_Mm01_00096061 predicted 314
12 SASI_Mm01_00096063 predicted 273
13 SASI_Mm01_00096065 predicted 317
14 SASI_Mm01_00096067 predicted 153
15 SASI_Mm01_00096068 predicted 228
16 SASI_Mm01_00096069 predicted 207
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019059
VALIDATED
TOMM7 MISSION shRNA Bacterial Glycerol Stock
translocase of outer mitochondrial membrane 7 homolog (yeast)
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000352897    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019059.2-256s21c1
Sequence:CCGGCTCGGATAAGAGATGGGACATCTCGAGATGTCCCATCTCTTATCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343315    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019059.2-327s21c1
Sequence:CCGGGCAGAGTGGATCTTGTACTAACTCGAGTTAGTACAAGATCCACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019059.2-151s21c1
Sequence:CCGGGAATGCCTGAACCAACTGTTTCTCGAGAAACAGTTGGTTCAGGCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019059.2-100s21c1
Sequence:CCGGGCTTTATCCCTCTTGTGATTTCTCGAGAAATCACAAGAGGGATAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164552    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019059.2-108s1c1
Sequence:CCGGCCTCTTGTGATTTACCTGGGACTCGAGTCCCAGGTAAATCACAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_019059.2-100s1c1
Sequence:CCGGGCTTTATCCCTCTTGTGATTTCTCGAGAAATCACAAGAGGGATAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158618    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019059.2-101s1c1
Sequence:CCGGCTTTATCCCTCTTGTGATTTACTCGAGTAAATCACAAGAGGGATAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158967    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_019059.2-407s1c1
Sequence:CCGGGAATTGAACATGCTAGGATTACTCGAGTAATCCTAGCATGTTCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161072    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_019059.2-327s1c1
Sequence:CCGGGCAGAGTGGATCTTGTACTAACTCGAGTTAGTACAAGATCCACTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_019059.2-151s1c1
Sequence:CCGGGAATGCCTGAACCAACTGTTTCTCGAGAAACAGTTGGTTCAGGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163872    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_019059.2-256s1c1
Sequence:CCGGCTCGGATAAGAGATGGGACATCTCGAGATGTCCCATCTCTTATCCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162944    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019059.2-53s1c1
Sequence:CCGGGAGACTACAGCAGCTCTTCAACTCGAGTTGAAGAGCTGCTGTAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019059
VALIDATED
TOMM7 MISSION shRNA shRNA Plasmid DNA
translocase of outer mitochondrial membrane 7 homolog (yeast)
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000352897    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019059.2-256s21c1
Sequence:CCGGCTCGGATAAGAGATGGGACATCTCGAGATGTCCCATCTCTTATCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343315    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019059.2-327s21c1
Sequence:CCGGGCAGAGTGGATCTTGTACTAACTCGAGTTAGTACAAGATCCACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019059.2-151s21c1
Sequence:CCGGGAATGCCTGAACCAACTGTTTCTCGAGAAACAGTTGGTTCAGGCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019059.2-100s21c1
Sequence:CCGGGCTTTATCCCTCTTGTGATTTCTCGAGAAATCACAAGAGGGATAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164552    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019059.2-108s1c1
Sequence:CCGGCCTCTTGTGATTTACCTGGGACTCGAGTCCCAGGTAAATCACAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_019059.2-100s1c1
Sequence:CCGGGCTTTATCCCTCTTGTGATTTCTCGAGAAATCACAAGAGGGATAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158618    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019059.2-101s1c1
Sequence:CCGGCTTTATCCCTCTTGTGATTTACTCGAGTAAATCACAAGAGGGATAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158967    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_019059.2-407s1c1
Sequence:CCGGGAATTGAACATGCTAGGATTACTCGAGTAATCCTAGCATGTTCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161072    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_019059.2-327s1c1
Sequence:CCGGGCAGAGTGGATCTTGTACTAACTCGAGTTAGTACAAGATCCACTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_019059.2-151s1c1
Sequence:CCGGGAATGCCTGAACCAACTGTTTCTCGAGAAACAGTTGGTTCAGGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163872    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_019059.2-256s1c1
Sequence:CCGGCTCGGATAAGAGATGGGACATCTCGAGATGTCCCATCTCTTATCCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162944    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019059.2-53s1c1
Sequence:CCGGGAGACTACAGCAGCTCTTCAACTCGAGTTGAAGAGCTGCTGTAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019059
VALIDATED
TOMM7 MISSION shRNA Lentiviral Transduction Particles
translocase of outer mitochondrial membrane 7 homolog (yeast)
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000352897    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019059.2-256s21c1
Sequence:CCGGCTCGGATAAGAGATGGGACATCTCGAGATGTCCCATCTCTTATCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343315    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019059.2-327s21c1
Sequence:CCGGGCAGAGTGGATCTTGTACTAACTCGAGTTAGTACAAGATCCACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019059.2-151s21c1
Sequence:CCGGGAATGCCTGAACCAACTGTTTCTCGAGAAACAGTTGGTTCAGGCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019059.2-100s21c1
Sequence:CCGGGCTTTATCCCTCTTGTGATTTCTCGAGAAATCACAAGAGGGATAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164552    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019059.2-108s1c1
Sequence:CCGGCCTCTTGTGATTTACCTGGGACTCGAGTCCCAGGTAAATCACAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_019059.2-100s1c1
Sequence:CCGGGCTTTATCCCTCTTGTGATTTCTCGAGAAATCACAAGAGGGATAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158618    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019059.2-101s1c1
Sequence:CCGGCTTTATCCCTCTTGTGATTTACTCGAGTAAATCACAAGAGGGATAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158967    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_019059.2-407s1c1
Sequence:CCGGGAATTGAACATGCTAGGATTACTCGAGTAATCCTAGCATGTTCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161072    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_019059.2-327s1c1
Sequence:CCGGGCAGAGTGGATCTTGTACTAACTCGAGTTAGTACAAGATCCACTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_019059.2-151s1c1
Sequence:CCGGGAATGCCTGAACCAACTGTTTCTCGAGAAACAGTTGGTTCAGGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163872    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_019059.2-256s1c1
Sequence:CCGGCTCGGATAAGAGATGGGACATCTCGAGATGTCCCATCTCTTATCCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162944    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019059.2-53s1c1
Sequence:CCGGGAGACTACAGCAGCTCTTCAACTCGAGTTGAAGAGCTGCTGTAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025394
TOMM7 MISSION shRNA Bacterial Glycerol Stock
translocase of outer mitochondrial membrane 7 homolog (yeast)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000247030    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025394.3-615s21c1
Sequence:CCGGTAAGTATGCTGGGACTAATAGCTCGAGCTATTAGTCCCAGCATACTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216549    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025394.3-923s1c1
Sequence:CCGGGTAGATTAAATGAGTCTAGAACTCGAGTTCTAGACTCATTTAATCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217290    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025394.3-689s1c1
Sequence:CCGGGTGCTTGAGTACTGCCTTAAACTCGAGTTTAAGGCAGTACTCAAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247032    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025394.3-473s21c1
Sequence:CCGGTTGTACCAGTGTAGAAGTAAGCTCGAGCTTACTTCTACACTGGTACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247033    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025394.3-846s21c1
Sequence:CCGGACTGTAAGAAATGACGGTTTACTCGAGTAAACCGTCATTTCTTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247031    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025394.3-728s21c1
Sequence:CCGGGGAGTTCCTGGTTGGTCATTTCTCGAGAAATGACCAACCAGGAACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257589    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025394.3-447s21c1
Sequence:CCGGCTCTTGGTATGTATGTTTATACTCGAGTATAAACATACATACCAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181095    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025394.1-125s1c1
Sequence:CCGGCGTGATTTACCTGGGATTTACCTCGAGGTAAATCCCAGGTAAATCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025394
TOMM7 MISSION shRNA shRNA Plasmid DNA
translocase of outer mitochondrial membrane 7 homolog (yeast)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000247030    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025394.3-615s21c1
Sequence:CCGGTAAGTATGCTGGGACTAATAGCTCGAGCTATTAGTCCCAGCATACTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216549    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025394.3-923s1c1
Sequence:CCGGGTAGATTAAATGAGTCTAGAACTCGAGTTCTAGACTCATTTAATCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217290    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025394.3-689s1c1
Sequence:CCGGGTGCTTGAGTACTGCCTTAAACTCGAGTTTAAGGCAGTACTCAAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247032    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025394.3-473s21c1
Sequence:CCGGTTGTACCAGTGTAGAAGTAAGCTCGAGCTTACTTCTACACTGGTACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247033    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025394.3-846s21c1
Sequence:CCGGACTGTAAGAAATGACGGTTTACTCGAGTAAACCGTCATTTCTTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247031    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025394.3-728s21c1
Sequence:CCGGGGAGTTCCTGGTTGGTCATTTCTCGAGAAATGACCAACCAGGAACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257589    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025394.3-447s21c1
Sequence:CCGGCTCTTGGTATGTATGTTTATACTCGAGTATAAACATACATACCAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181095    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025394.1-125s1c1
Sequence:CCGGCGTGATTTACCTGGGATTTACCTCGAGGTAAATCCCAGGTAAATCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025394
TOMM7 MISSION shRNA Lentiviral Transduction Particles
translocase of outer mitochondrial membrane 7 homolog (yeast)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000247030    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025394.3-615s21c1
Sequence:CCGGTAAGTATGCTGGGACTAATAGCTCGAGCTATTAGTCCCAGCATACTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216549    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025394.3-923s1c1
Sequence:CCGGGTAGATTAAATGAGTCTAGAACTCGAGTTCTAGACTCATTTAATCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217290    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025394.3-689s1c1
Sequence:CCGGGTGCTTGAGTACTGCCTTAAACTCGAGTTTAAGGCAGTACTCAAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247032    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025394.3-473s21c1
Sequence:CCGGTTGTACCAGTGTAGAAGTAAGCTCGAGCTTACTTCTACACTGGTACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247033    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025394.3-846s21c1
Sequence:CCGGACTGTAAGAAATGACGGTTTACTCGAGTAAACCGTCATTTCTTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247031    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025394.3-728s21c1
Sequence:CCGGGGAGTTCCTGGTTGGTCATTTCTCGAGAAATGACCAACCAGGAACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257589    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025394.3-447s21c1
Sequence:CCGGCTCTTGGTATGTATGTTTATACTCGAGTATAAACATACATACCAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181095    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025394.1-125s1c1
Sequence:CCGGCGTGATTTACCTGGGATTTACCTCGAGGTAAATCCCAGGTAAATCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks