EMAIL THIS PAGE TO A FRIEND

TONSL

tonsoku-like, DNA repair protein

Synonyms: IKBR NFKBIL2
UniProtKB ID: Q96HA7, B5MDP0, C9JKB1, C9JNV8, Q13006, Q9UGJ2
Gene ID:
Human(4796) Summary: The protein encoded by this gene is thought to be a negative regulator of NF-kappa-B mediated transcription. The encoded protein may bind NF-kappa-B complexes and trap them in the cytoplasm, preventing them from entering the nucleus and interacting with the DNA. Phosphorylation of this protein targets it for degradation by the ubiquitination pathway, which frees the NF-kappa-B complexes to enter the nucleus. [provided by RefSeq, Jul 2008]
Mouse(72749) tonsoku-like, DNA repair protein
Rat(366953) tonsoku-like, DNA repair protein
domestic cat(101081192) tonsoku-like, DNA repair protein
dog(475127) tonsoku-like, DNA repair protein
cow(505102) tonsoku-like, DNA repair protein
sheep(101116737) tonsoku-like, DNA repair protein
naked mole-rat(101717364) tonsoku-like, DNA repair protein
domestic guinea pig(100734969) tonsoku-like, DNA repair protein
52 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013432 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013432 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013432 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_183091 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183091 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183091 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013432 Rosetta Predictions human pricing
NM_001130572 Rosetta Predictions rat pricing
NM_183091 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013432 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00112674 predicted 3925
2 SASI_Hs01_00112675 predicted 1180
3 SASI_Hs01_00112676 predicted 623
4 SASI_Hs01_00112677 predicted 3540
5 SASI_Hs02_00344821 predicted 296
6 SASI_Hs01_00112678 predicted 708
7 SASI_Hs01_00112679 predicted 861
8 SASI_Hs01_00112680 predicted 1712
9 SASI_Hs01_00112681 predicted 762
10 SASI_Hs01_00112682 predicted 3706
11 SASI_Hs01_00112683 predicted 811
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130572 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00255889 predicted 1778
2 SASI_Rn02_00255890 predicted 863
3 SASI_Rn02_00255891 predicted 906
4 SASI_Rn02_00255892 predicted 3455
5 SASI_Rn02_00255893 predicted 3611
6 SASI_Rn02_00255894 predicted 1226
7 SASI_Rn02_00255895 predicted 3757
8 SASI_Rn02_00255896 predicted 677
9 SASI_Rn02_00255897 predicted 3532
10 SASI_Rn02_00255898 predicted 2836
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183091 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00129632 predicted 3763
2 SASI_Mm01_00129633 predicted 844
3 SASI_Mm01_00129635 predicted 2655
4 SASI_Mm01_00129636 predicted 3018
5 SASI_Mm01_00129637 predicted 1209
6 SASI_Mm01_00129638 predicted 3953
7 SASI_Mm01_00129639 predicted 3721
8 SASI_Mm02_00350079 predicted 3792
9 SASI_Mm01_00129640 predicted 1752
10 SASI_Mm01_00129641 predicted 664
11 SASI_Mm01_00129634 predicted 2185
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013432
VALIDATED
TONSL MISSION shRNA Bacterial Glycerol Stock
tonsoku-like, DNA repair protein
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000424634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013432.4-739s21c1
Sequence:CCGGAGCGAGTGCTGCGTGGTTATTCTCGAGAATAACCACGCAGCACTCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013432.4-426s21c1
Sequence:CCGGTGAGAAGAGCTTGGCTATTGTCTCGAGACAATAGCCAAGCTCTTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013432.4-3721s21c1
Sequence:CCGGATGGAGCCTGTATTCCGATACCTCGAGGTATCGGAATACAGGCTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_013432.3-569s1c1
Sequence:CCGGCCACCTTTACGAGGACCTATTCTCGAGAATAGGTCCTCGTAAAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013432.3-3372s1c1
Sequence:CCGGAGTTTGGAGGAGCTGGACTTACTCGAGTAAGTCCAGCTCCTCCAAACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013432.3-524s1c1
Sequence:CCGGGTGCAACGATTACTTCAGGAACTCGAGTTCCTGAAGTAATCGTTGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_013432.3-4088s1c1
Sequence:CCGGCCACGGCTCCAAGCTCTTCTTCTCGAGAAGAAGAGCTTGGAGCCGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013432
VALIDATED
TONSL MISSION shRNA shRNA Plasmid DNA
tonsoku-like, DNA repair protein
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000424634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013432.4-739s21c1
Sequence:CCGGAGCGAGTGCTGCGTGGTTATTCTCGAGAATAACCACGCAGCACTCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013432.4-426s21c1
Sequence:CCGGTGAGAAGAGCTTGGCTATTGTCTCGAGACAATAGCCAAGCTCTTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013432.4-3721s21c1
Sequence:CCGGATGGAGCCTGTATTCCGATACCTCGAGGTATCGGAATACAGGCTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_013432.3-569s1c1
Sequence:CCGGCCACCTTTACGAGGACCTATTCTCGAGAATAGGTCCTCGTAAAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013432.3-3372s1c1
Sequence:CCGGAGTTTGGAGGAGCTGGACTTACTCGAGTAAGTCCAGCTCCTCCAAACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013432.3-524s1c1
Sequence:CCGGGTGCAACGATTACTTCAGGAACTCGAGTTCCTGAAGTAATCGTTGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_013432.3-4088s1c1
Sequence:CCGGCCACGGCTCCAAGCTCTTCTTCTCGAGAAGAAGAGCTTGGAGCCGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013432
VALIDATED
TONSL MISSION shRNA Lentiviral Transduction Particles
tonsoku-like, DNA repair protein
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000424634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013432.4-739s21c1
Sequence:CCGGAGCGAGTGCTGCGTGGTTATTCTCGAGAATAACCACGCAGCACTCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013432.4-426s21c1
Sequence:CCGGTGAGAAGAGCTTGGCTATTGTCTCGAGACAATAGCCAAGCTCTTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013432.4-3721s21c1
Sequence:CCGGATGGAGCCTGTATTCCGATACCTCGAGGTATCGGAATACAGGCTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_013432.3-569s1c1
Sequence:CCGGCCACCTTTACGAGGACCTATTCTCGAGAATAGGTCCTCGTAAAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013432.3-3372s1c1
Sequence:CCGGAGTTTGGAGGAGCTGGACTTACTCGAGTAAGTCCAGCTCCTCCAAACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013432.3-524s1c1
Sequence:CCGGGTGCAACGATTACTTCAGGAACTCGAGTTCCTGAAGTAATCGTTGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_013432.3-4088s1c1
Sequence:CCGGCCACGGCTCCAAGCTCTTCTTCTCGAGAAGAAGAGCTTGGAGCCGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183091
TONSL MISSION shRNA Bacterial Glycerol Stock
tonsoku-like, DNA repair protein
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000418576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183091.3-3723s21c1
Sequence:CCGGCATAGAGCCTGTTATCAAATACTCGAGTATTTGATAACAGGCTCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183091.2-1738s1c1
Sequence:CCGGGCATGCAACTATGGACATCTTCTCGAGAAGATGTCCATAGTTGCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183091.2-2812s1c1
Sequence:CCGGGTTCAAATTCAGGATAACCTTCTCGAGAAGGTTATCCTGAATTTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183091.2-2183s1c1
Sequence:CCGGCTAAAGTCTTTCTGGAGGAAACTCGAGTTTCCTCCAGAAAGACTTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183091.2-1867s1c1
Sequence:CCGGGAGGTAGCTGAATTACTCATTCTCGAGAATGAGTAATTCAGCTACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183091.2-891s1c1
Sequence:CCGGCAAGTATGTATTGGCAGTGATCTCGAGATCACTGCCAATACATACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183091
TONSL MISSION shRNA shRNA Plasmid DNA
tonsoku-like, DNA repair protein
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000418576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183091.3-3723s21c1
Sequence:CCGGCATAGAGCCTGTTATCAAATACTCGAGTATTTGATAACAGGCTCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183091.2-1738s1c1
Sequence:CCGGGCATGCAACTATGGACATCTTCTCGAGAAGATGTCCATAGTTGCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183091.2-2812s1c1
Sequence:CCGGGTTCAAATTCAGGATAACCTTCTCGAGAAGGTTATCCTGAATTTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183091.2-2183s1c1
Sequence:CCGGCTAAAGTCTTTCTGGAGGAAACTCGAGTTTCCTCCAGAAAGACTTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183091.2-1867s1c1
Sequence:CCGGGAGGTAGCTGAATTACTCATTCTCGAGAATGAGTAATTCAGCTACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183091.2-891s1c1
Sequence:CCGGCAAGTATGTATTGGCAGTGATCTCGAGATCACTGCCAATACATACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183091
TONSL MISSION shRNA Lentiviral Transduction Particles
tonsoku-like, DNA repair protein
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000418576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183091.3-3723s21c1
Sequence:CCGGCATAGAGCCTGTTATCAAATACTCGAGTATTTGATAACAGGCTCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183091.2-1738s1c1
Sequence:CCGGGCATGCAACTATGGACATCTTCTCGAGAAGATGTCCATAGTTGCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183091.2-2812s1c1
Sequence:CCGGGTTCAAATTCAGGATAACCTTCTCGAGAAGGTTATCCTGAATTTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183091.2-2183s1c1
Sequence:CCGGCTAAAGTCTTTCTGGAGGAAACTCGAGTTTCCTCCAGAAAGACTTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183091.2-1867s1c1
Sequence:CCGGGAGGTAGCTGAATTACTCATTCTCGAGAATGAGTAATTCAGCTACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183091.2-891s1c1
Sequence:CCGGCAAGTATGTATTGGCAGTGATCTCGAGATCACTGCCAATACATACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks