EMAIL THIS PAGE TO A FRIEND

TOP1

topoisomerase (DNA) I

Synonyms: TOPI
Gene ID:
Human(7150) Summary: This gene encodes a DNA topoisomerase, an enzyme that controls and alters the topologic states of DNA during transcription. This enzyme catalyzes the transient breaking and rejoining of a single strand of DNA which allows the strands to pass through one another, thus altering the topology of DNA. This gene is localized to chromosome 20 and has pseudogenes which reside on chromosomes 1 and 22. [provided by RefSeq, Jul 2008]
Mouse(21969) topoisomerase (DNA) I
Rat(64550) topoisomerase (DNA) I
fruit fly(32458) Topoisomerase 1
domestic cat(101093174) topoisomerase (DNA) I
dog(477229) topoisomerase (DNA) I
chicken(396004) topoisomerase (DNA) I
Zebrafish(327179) topoisomerase (DNA) I
domestic guinea pig(100716716) topoisomerase (DNA) I
naked mole-rat(101704241) topoisomerase (DNA) I
cow(534799) topoisomerase (DNA) I
sheep(101103086) topoisomerase (DNA) I
114 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009408 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009408 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009408 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003286 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003286 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003286 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003286 Rosetta Predictions human pricing
NM_022615 Rosetta Predictions rat pricing
NM_009408 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003286 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00335354 predicted 1607
2 SASI_Hs01_00047440 predicted 1276
3 SASI_Hs01_00047441 predicted 285
4 SASI_Hs01_00047442 predicted 1367
5 SASI_Hs02_00335355 predicted 397
6 SASI_Hs01_00047444 predicted 1439
7 SASI_Hs01_00047445 predicted 269
8 SASI_Hs01_00047447 predicted 1526
9 SASI_Hs01_00047448 predicted 1650
10 SASI_Hs01_00047449 predicted 1125
11 SASI_Hs01_00047443 predicted 2458
12 SASI_Hs01_00047446 predicted 1807
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022615 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00045320 predicted 1913
2 SASI_Rn01_00045321 predicted 1521
3 SASI_Rn01_00045322 predicted 1713
4 SASI_Rn01_00045323 predicted 1701
5 SASI_Rn01_00045324 predicted 1841
6 SASI_Rn01_00045325 predicted 1376
7 SASI_Rn01_00045326 predicted 1326
8 SASI_Rn01_00045327 predicted 1933
9 SASI_Rn01_00045328 predicted 1844
10 SASI_Rn01_00045329 predicted 1736
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009408 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00038485 predicted 2250
2 SASI_Mm01_00038488 predicted 2552
3 SASI_Mm01_00038489 predicted 1704
4 SASI_Mm02_00316047 predicted 2265
5 SASI_Mm02_00316048 predicted 1739
6 SASI_Mm01_00038490 predicted 2065
7 SASI_Mm01_00038491 predicted 2174
8 SASI_Mm02_00316049 predicted 973
9 SASI_Mm01_00038494 predicted 964
10 SASI_Mm02_00316050 predicted 1022
11 SASI_Mm01_00038486 predicted 1406
12 SASI_Mm01_00038487 predicted 2248
13 SASI_Mm01_00038492 predicted 1569
14 SASI_Mm01_00038493 predicted 337
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009408
VALIDATED
TOP1 MISSION shRNA Bacterial Glycerol Stock
topoisomerase (DNA) I
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000011883    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009408.1-2395s1c1
Sequence:CCGGCCACAAGTCTTAACAAACCAACTCGAGTTGGTTTGTTAAGACTTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009408.1-343s1c1
Sequence:CCGGCCGCCACGAATTAAAGATGAACTCGAGTTCATCTTTAATTCGTGGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009408.1-1944s1c1
Sequence:CCGGGCAGTCTAAGATTGATGCCAACTCGAGTTGGCATCAATCTTAGACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009408.1-1840s1c1
Sequence:CCGGCCAGCGAAGATTCTATCTTATCTCGAGATAAGATAGAATCTTCGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009408.2-1901s21c1
Sequence:CCGGAGGAGTATGTGGTGGAATTTGCTCGAGCAAATTCCACCACATACTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009408.2-763s21c1
Sequence:CCGGGAAGATGATGCTGATTATAAACTCGAGTTTATAATCAGCATCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009408.2-1936s21c1
Sequence:CCGGGACTCAATCAGATACTATAACCTCGAGGTTATAGTATCTGATTGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009408.2-1226s21c1
Sequence:CCGGACCTAAGCAAATGCGACTTTACTCGAGTAAAGTCGCATTTGCTTAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009408.2-420s21c1
Sequence:CCGGAGATCGAGAACACCGGCATAACTCGAGTTATGCCGGTGTTCTCGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009408
VALIDATED
TOP1 MISSION shRNA shRNA Plasmid DNA
topoisomerase (DNA) I
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000011883    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009408.1-2395s1c1
Sequence:CCGGCCACAAGTCTTAACAAACCAACTCGAGTTGGTTTGTTAAGACTTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009408.1-343s1c1
Sequence:CCGGCCGCCACGAATTAAAGATGAACTCGAGTTCATCTTTAATTCGTGGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009408.1-1944s1c1
Sequence:CCGGGCAGTCTAAGATTGATGCCAACTCGAGTTGGCATCAATCTTAGACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009408.1-1840s1c1
Sequence:CCGGCCAGCGAAGATTCTATCTTATCTCGAGATAAGATAGAATCTTCGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009408.2-1901s21c1
Sequence:CCGGAGGAGTATGTGGTGGAATTTGCTCGAGCAAATTCCACCACATACTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009408.2-763s21c1
Sequence:CCGGGAAGATGATGCTGATTATAAACTCGAGTTTATAATCAGCATCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009408.2-1936s21c1
Sequence:CCGGGACTCAATCAGATACTATAACCTCGAGGTTATAGTATCTGATTGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009408.2-1226s21c1
Sequence:CCGGACCTAAGCAAATGCGACTTTACTCGAGTAAAGTCGCATTTGCTTAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009408.2-420s21c1
Sequence:CCGGAGATCGAGAACACCGGCATAACTCGAGTTATGCCGGTGTTCTCGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009408
VALIDATED
TOP1 MISSION shRNA Lentiviral Transduction Particles
topoisomerase (DNA) I
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000011883    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009408.1-2395s1c1
Sequence:CCGGCCACAAGTCTTAACAAACCAACTCGAGTTGGTTTGTTAAGACTTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009408.1-343s1c1
Sequence:CCGGCCGCCACGAATTAAAGATGAACTCGAGTTCATCTTTAATTCGTGGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009408.1-1944s1c1
Sequence:CCGGGCAGTCTAAGATTGATGCCAACTCGAGTTGGCATCAATCTTAGACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009408.1-1840s1c1
Sequence:CCGGCCAGCGAAGATTCTATCTTATCTCGAGATAAGATAGAATCTTCGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009408.2-1901s21c1
Sequence:CCGGAGGAGTATGTGGTGGAATTTGCTCGAGCAAATTCCACCACATACTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009408.2-763s21c1
Sequence:CCGGGAAGATGATGCTGATTATAAACTCGAGTTTATAATCAGCATCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009408.2-1936s21c1
Sequence:CCGGGACTCAATCAGATACTATAACCTCGAGGTTATAGTATCTGATTGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009408.2-1226s21c1
Sequence:CCGGACCTAAGCAAATGCGACTTTACTCGAGTAAAGTCGCATTTGCTTAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009408.2-420s21c1
Sequence:CCGGAGATCGAGAACACCGGCATAACTCGAGTTATGCCGGTGTTCTCGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003286
VALIDATED
TOP1 MISSION shRNA Bacterial Glycerol Stock
topoisomerase (DNA) I
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000003988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003286.x-391s1c1
Sequence:CCGGCATAGCAACAGTGAACATAAACTCGAGTTTATGTTCACTGTTGCTATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003286.x-1793s1c1
Sequence:CCGGCAGAGTTGGATGGTCAGGAATCTCGAGATTCCTGACCATCCAACTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_003286.x-572s1c1
Sequence:CCGGGCTTCTCTAGTCCACCACAAACTCGAGTTTGTGGTGGACTAGAGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003286.x-1038s1c1
Sequence:CCGGCGACCATGAATATACTACCAACTCGAGTTGGTAGTATATTCATGGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003286.2-391s21c1
Sequence:CCGGCATAGCAACAGTGAACATAAACTCGAGTTTATGTTCACTGTTGCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003286.2-572s21c1
Sequence:CCGGGCTTCTCTAGTCCACCACAAACTCGAGTTTGTGGTGGACTAGAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318568    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_003286.2-3273s21c1
Sequence:CCGGTGAAGGGCGAGTGAATCTAAGCTCGAGCTTAGATTCACTCGCCCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003286.2-1793s21c1
Sequence:CCGGCAGAGTTGGATGGTCAGGAATCTCGAGATTCCTGACCATCCAACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003286
VALIDATED
TOP1 MISSION shRNA shRNA Plasmid DNA
topoisomerase (DNA) I
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000003988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003286.x-391s1c1
Sequence:CCGGCATAGCAACAGTGAACATAAACTCGAGTTTATGTTCACTGTTGCTATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003286.x-1793s1c1
Sequence:CCGGCAGAGTTGGATGGTCAGGAATCTCGAGATTCCTGACCATCCAACTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_003286.x-572s1c1
Sequence:CCGGGCTTCTCTAGTCCACCACAAACTCGAGTTTGTGGTGGACTAGAGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003286.x-1038s1c1
Sequence:CCGGCGACCATGAATATACTACCAACTCGAGTTGGTAGTATATTCATGGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003286.2-391s21c1
Sequence:CCGGCATAGCAACAGTGAACATAAACTCGAGTTTATGTTCACTGTTGCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003286.2-572s21c1
Sequence:CCGGGCTTCTCTAGTCCACCACAAACTCGAGTTTGTGGTGGACTAGAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318568    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_003286.2-3273s21c1
Sequence:CCGGTGAAGGGCGAGTGAATCTAAGCTCGAGCTTAGATTCACTCGCCCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003286.2-1793s21c1
Sequence:CCGGCAGAGTTGGATGGTCAGGAATCTCGAGATTCCTGACCATCCAACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003286
VALIDATED
TOP1 MISSION shRNA Lentiviral Transduction Particles
topoisomerase (DNA) I
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000003988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003286.x-391s1c1
Sequence:CCGGCATAGCAACAGTGAACATAAACTCGAGTTTATGTTCACTGTTGCTATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003286.x-1793s1c1
Sequence:CCGGCAGAGTTGGATGGTCAGGAATCTCGAGATTCCTGACCATCCAACTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_003286.x-572s1c1
Sequence:CCGGGCTTCTCTAGTCCACCACAAACTCGAGTTTGTGGTGGACTAGAGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003286.x-1038s1c1
Sequence:CCGGCGACCATGAATATACTACCAACTCGAGTTGGTAGTATATTCATGGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003286.2-391s21c1
Sequence:CCGGCATAGCAACAGTGAACATAAACTCGAGTTTATGTTCACTGTTGCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003286.2-572s21c1
Sequence:CCGGGCTTCTCTAGTCCACCACAAACTCGAGTTTGTGGTGGACTAGAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318568    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_003286.2-3273s21c1
Sequence:CCGGTGAAGGGCGAGTGAATCTAAGCTCGAGCTTAGATTCACTCGCCCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003286.2-1793s21c1
Sequence:CCGGCAGAGTTGGATGGTCAGGAATCTCGAGATTCCTGACCATCCAACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks