EMAIL THIS PAGE TO A FRIEND

TOP1MT

topoisomerase (DNA) I, mitochondrial

UniProtKB ID: Q969P6, B7ZAR5, E7ES89, Q86ST4, Q86V82
Gene ID:
Human(116447) Summary: This gene encodes a mitochondrial DNA topoisomerase that plays a role in the modification of DNA topology. The encoded protein is a type IB topoisomerase and catalyzes the transient breaking and rejoining of DNA to relieve tension and DNA supercoiling generated in the mitochondrial genome during replication and transcription. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, May 2012]
Mouse(72960) DNA topoisomerase 1, mitochondrial
Rat(300029) topoisomerase (DNA) I, mitochondrial
Zebrafish(415098) mitochondrial topoisomerase I
chicken(408025) topoisomerase (DNA) I, mitochondrial
cow(618382) topoisomerase (DNA) I, mitochondrial
sheep(101114532) topoisomerase (DNA) I, mitochondrial
naked mole-rat(101726319) topoisomerase (DNA) I, mitochondrial
domestic guinea pig(100728586) topoisomerase (DNA) I, mitochondrial
45 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028404 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028404 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028404 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_052963 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052963 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052963 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU009411 MISSION® esiRNA esiRNA targeting human TOP1MT (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052963 Rosetta Predictions human pricing
NM_001002798 Rosetta Predictions rat pricing
NM_028404 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052963 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00151452 predicted 782
2 SASI_Hs01_00151453 predicted 1081
3 SASI_Hs01_00151454 predicted 308
4 SASI_Hs01_00151455 predicted 1356
5 SASI_Hs02_00361767 predicted 423
6 SASI_Hs01_00151456 predicted 837
7 SASI_Hs01_00151457 predicted 1161
8 SASI_Hs01_00151458 predicted 1466
9 SASI_Hs01_00151459 predicted 1281
10 SASI_Hs01_00151460 predicted 530
11 SASI_Hs01_00151461 predicted 910
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002798 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00098118 predicted 283
2 SASI_Rn01_00098119 predicted 881
3 SASI_Rn01_00098120 predicted 828
4 SASI_Rn01_00098121 predicted 523
5 SASI_Rn01_00098123 predicted 1212
6 SASI_Rn01_00098124 predicted 779
7 SASI_Rn02_00197980 predicted 673
8 SASI_Rn01_00098126 predicted 780
9 SASI_Rn01_00098127 predicted 1217
10 SASI_Rn02_00197981 predicted 1103
11 SASI_Rn01_00098122 predicted 1402
12 SASI_Rn01_00098125 predicted 1113
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028404 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00150285 predicted 526
2 SASI_Mm01_00150286 predicted 528
3 SASI_Mm01_00150287 predicted 413
4 SASI_Mm01_00150288 predicted 396
5 SASI_Mm01_00150289 predicted 827
6 SASI_Mm01_00150290 predicted 328
7 SASI_Mm01_00150291 predicted 1610
8 SASI_Mm01_00150292 predicted 1405
9 SASI_Mm01_00150293 predicted 877
10 SASI_Mm01_00150294 predicted 779
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028404
VALIDATED
TOP1MT MISSION shRNA Bacterial Glycerol Stock
topoisomerase (DNA) I, mitochondrial
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000324158    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028404.2-1831s21c1
Sequence:CCGGGCTGAAATGTTCTTTCTCACTCTCGAGAGTGAGAAAGAACATTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028404.2-655s21c1
Sequence:CCGGGCCAGAGGATGTGGTCATTAACTCGAGTTAATGACCACATCCTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028404.2-313s21c1
Sequence:CCGGGCATCTTGAGTGTACGAGCAACTCGAGTTGCTCGTACACTCAAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028404.2-1586s21c1
Sequence:CCGGCGATTGTTAAAGCTGGAAGAACTCGAGTTCTTCCAGCTTTAACAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028404.2-1087s21c1
Sequence:CCGGGCACGTTGTAGAGCTGGACTTCTCGAGAAGTCCAGCTCTACAACGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114686    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028404.1-1832s1c1
Sequence:CCGGGCTGAAATGTTCTTTCTCACTCTCGAGAGTGAGAAAGAACATTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028404.1-656s1c1
Sequence:CCGGGCCAGAGGATGTGGTCATTAACTCGAGTTAATGACCACATCCTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028404.1-1088s1c1
Sequence:CCGGGCACGTTGTAGAGCTGGACTTCTCGAGAAGTCCAGCTCTACAACGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028404.1-1587s1c1
Sequence:CCGGCGATTGTTAAAGCTGGAAGAACTCGAGTTCTTCCAGCTTTAACAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028404.1-314s1c1
Sequence:CCGGGCATCTTGAGTGTACGAGCAACTCGAGTTGCTCGTACACTCAAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028404
VALIDATED
TOP1MT MISSION shRNA shRNA Plasmid DNA
topoisomerase (DNA) I, mitochondrial
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000324158    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028404.2-1831s21c1
Sequence:CCGGGCTGAAATGTTCTTTCTCACTCTCGAGAGTGAGAAAGAACATTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028404.2-655s21c1
Sequence:CCGGGCCAGAGGATGTGGTCATTAACTCGAGTTAATGACCACATCCTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028404.2-313s21c1
Sequence:CCGGGCATCTTGAGTGTACGAGCAACTCGAGTTGCTCGTACACTCAAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028404.2-1586s21c1
Sequence:CCGGCGATTGTTAAAGCTGGAAGAACTCGAGTTCTTCCAGCTTTAACAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028404.2-1087s21c1
Sequence:CCGGGCACGTTGTAGAGCTGGACTTCTCGAGAAGTCCAGCTCTACAACGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114686    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028404.1-1832s1c1
Sequence:CCGGGCTGAAATGTTCTTTCTCACTCTCGAGAGTGAGAAAGAACATTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028404.1-656s1c1
Sequence:CCGGGCCAGAGGATGTGGTCATTAACTCGAGTTAATGACCACATCCTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028404.1-1088s1c1
Sequence:CCGGGCACGTTGTAGAGCTGGACTTCTCGAGAAGTCCAGCTCTACAACGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028404.1-1587s1c1
Sequence:CCGGCGATTGTTAAAGCTGGAAGAACTCGAGTTCTTCCAGCTTTAACAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028404.1-314s1c1
Sequence:CCGGGCATCTTGAGTGTACGAGCAACTCGAGTTGCTCGTACACTCAAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028404
VALIDATED
TOP1MT MISSION shRNA Lentiviral Transduction Particles
topoisomerase (DNA) I, mitochondrial
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000324158    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028404.2-1831s21c1
Sequence:CCGGGCTGAAATGTTCTTTCTCACTCTCGAGAGTGAGAAAGAACATTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028404.2-655s21c1
Sequence:CCGGGCCAGAGGATGTGGTCATTAACTCGAGTTAATGACCACATCCTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028404.2-313s21c1
Sequence:CCGGGCATCTTGAGTGTACGAGCAACTCGAGTTGCTCGTACACTCAAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028404.2-1586s21c1
Sequence:CCGGCGATTGTTAAAGCTGGAAGAACTCGAGTTCTTCCAGCTTTAACAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028404.2-1087s21c1
Sequence:CCGGGCACGTTGTAGAGCTGGACTTCTCGAGAAGTCCAGCTCTACAACGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114686    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028404.1-1832s1c1
Sequence:CCGGGCTGAAATGTTCTTTCTCACTCTCGAGAGTGAGAAAGAACATTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028404.1-656s1c1
Sequence:CCGGGCCAGAGGATGTGGTCATTAACTCGAGTTAATGACCACATCCTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028404.1-1088s1c1
Sequence:CCGGGCACGTTGTAGAGCTGGACTTCTCGAGAAGTCCAGCTCTACAACGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028404.1-1587s1c1
Sequence:CCGGCGATTGTTAAAGCTGGAAGAACTCGAGTTCTTCCAGCTTTAACAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028404.1-314s1c1
Sequence:CCGGGCATCTTGAGTGTACGAGCAACTCGAGTTGCTCGTACACTCAAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052963
VALIDATED
TOP1MT MISSION shRNA Bacterial Glycerol Stock
topoisomerase (DNA) I, mitochondrial
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000292059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_052963.1-1168s21c1
Sequence:CCGGGTACAAGAACTTACAGCTCTTCTCGAGAAGAGCTGTAAGTTCTTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052963.1-661s21c1
Sequence:CCGGGCCAGAGGATGTGGTTATCAACTCGAGTTGATAACCACATCCTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_052963.1-442s21c1
Sequence:CCGGCCACAGATACTTTGTGGACAACTCGAGTTGTCCACAAAGTATCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_052963.1-532s21c1
Sequence:CCGGGCAAGAGTTCGGCTACTGTATCTCGAGATACAGTAGCCGAACTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_052963.1-1444s21c1
Sequence:CCGGGTTCGAGAAGTCGATGCAGAACTCGAGTTCTGCATCGACTTCTCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_052963.1-442s1c1
Sequence:CCGGCCACAGATACTTTGTGGACAACTCGAGTTGTCCACAAAGTATCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_052963.1-661s1c1
Sequence:CCGGGCCAGAGGATGTGGTTATCAACTCGAGTTGATAACCACATCCTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_052963.1-532s1c1
Sequence:CCGGGCAAGAGTTCGGCTACTGTATCTCGAGATACAGTAGCCGAACTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_052963.1-1168s1c1
Sequence:CCGGGTACAAGAACTTACAGCTCTTCTCGAGAAGAGCTGTAAGTTCTTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_052963.1-1444s1c1
Sequence:CCGGGTTCGAGAAGTCGATGCAGAACTCGAGTTCTGCATCGACTTCTCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052963
VALIDATED
TOP1MT MISSION shRNA shRNA Plasmid DNA
topoisomerase (DNA) I, mitochondrial
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000292059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_052963.1-1168s21c1
Sequence:CCGGGTACAAGAACTTACAGCTCTTCTCGAGAAGAGCTGTAAGTTCTTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052963.1-661s21c1
Sequence:CCGGGCCAGAGGATGTGGTTATCAACTCGAGTTGATAACCACATCCTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_052963.1-442s21c1
Sequence:CCGGCCACAGATACTTTGTGGACAACTCGAGTTGTCCACAAAGTATCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_052963.1-532s21c1
Sequence:CCGGGCAAGAGTTCGGCTACTGTATCTCGAGATACAGTAGCCGAACTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_052963.1-1444s21c1
Sequence:CCGGGTTCGAGAAGTCGATGCAGAACTCGAGTTCTGCATCGACTTCTCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_052963.1-442s1c1
Sequence:CCGGCCACAGATACTTTGTGGACAACTCGAGTTGTCCACAAAGTATCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_052963.1-661s1c1
Sequence:CCGGGCCAGAGGATGTGGTTATCAACTCGAGTTGATAACCACATCCTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_052963.1-532s1c1
Sequence:CCGGGCAAGAGTTCGGCTACTGTATCTCGAGATACAGTAGCCGAACTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_052963.1-1168s1c1
Sequence:CCGGGTACAAGAACTTACAGCTCTTCTCGAGAAGAGCTGTAAGTTCTTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_052963.1-1444s1c1
Sequence:CCGGGTTCGAGAAGTCGATGCAGAACTCGAGTTCTGCATCGACTTCTCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052963
VALIDATED
TOP1MT MISSION shRNA Lentiviral Transduction Particles
topoisomerase (DNA) I, mitochondrial
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000292059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_052963.1-1168s21c1
Sequence:CCGGGTACAAGAACTTACAGCTCTTCTCGAGAAGAGCTGTAAGTTCTTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052963.1-661s21c1
Sequence:CCGGGCCAGAGGATGTGGTTATCAACTCGAGTTGATAACCACATCCTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_052963.1-442s21c1
Sequence:CCGGCCACAGATACTTTGTGGACAACTCGAGTTGTCCACAAAGTATCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_052963.1-532s21c1
Sequence:CCGGGCAAGAGTTCGGCTACTGTATCTCGAGATACAGTAGCCGAACTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_052963.1-1444s21c1
Sequence:CCGGGTTCGAGAAGTCGATGCAGAACTCGAGTTCTGCATCGACTTCTCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_052963.1-442s1c1
Sequence:CCGGCCACAGATACTTTGTGGACAACTCGAGTTGTCCACAAAGTATCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_052963.1-661s1c1
Sequence:CCGGGCCAGAGGATGTGGTTATCAACTCGAGTTGATAACCACATCCTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_052963.1-532s1c1
Sequence:CCGGGCAAGAGTTCGGCTACTGTATCTCGAGATACAGTAGCCGAACTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_052963.1-1168s1c1
Sequence:CCGGGTACAAGAACTTACAGCTCTTCTCGAGAAGAGCTGTAAGTTCTTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_052963.1-1444s1c1
Sequence:CCGGGTTCGAGAAGTCGATGCAGAACTCGAGTTCTGCATCGACTTCTCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks