EMAIL THIS PAGE TO A FRIEND

TOP2A

topoisomerase (DNA) II alpha 170kDa

Synonyms: TOP2 TP2A
Gene ID:
Human(7153) Summary: This gene encodes a DNA topoisomerase, an enzyme that controls and alters the topologic states of DNA during transcription. This nuclear enzyme is involved in processes such as chromosome condensation, chromatid separation, and the relief of torsional stress that occurs during DNA transcription and replication. It catalyzes the transient breaking and rejoining of two strands of duplex DNA which allows the strands to pass through one another, thus altering the topology of DNA. Two forms of this enzyme exist as likely products of a gene duplication event. The gene encoding this form, alpha, is localized to chromosome 17 and the beta gene is localized to chromosome 3. The gene encoding this enzyme functions as the target for several anticancer agents and a variety of mutations in this gene have been associated with the development of drug resistance. Reduced activity of this enzyme may also play a role in ataxia-telangiectasia. [provided by RefSeq, Jul 2010]
Mouse(21973) topoisomerase (DNA) II alpha
Rat(360243) topoisomerase (DNA) II alpha
Zebrafish(323733) topoisomerase (DNA) II alpha
dog(480525) topoisomerase (DNA) II alpha 170kDa
domestic cat(101083813) topoisomerase (DNA) II alpha 170kDa
chicken(395570) topoisomerase (DNA) II alpha 170kDa
domestic guinea pig(100730168) topoisomerase (DNA) II alpha 170kDa
Domestic Rabbit(100357676) topoisomerase (DNA) II alpha 170kDa
cow(787696) topoisomerase (DNA) II alpha 170kDa
sheep(101108762) topoisomerase (DNA) II alpha 170kDa
108 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
A9809 Amsacrine hydrochloride ≥98% (TLC), powder human pricing
S4692 Sobuzoxane ≥99% (HPLC), solid human pricing
56968 Sparfloxacin ≥98.0% (HPLC) human pricing
33967 Sparfloxacin VETRANAL, analytical standard human pricing
E1383 Etoposide synthetic, ≥98%, powder human, mouse, rat pricing
D6128 5α-Cholestan-3β-ol ≥95% human, rat pricing
47129 Cholestanol solution certified reference material, 10 mg/mL in chloroform human, rat pricing
C8667 Cholesterol Sigma Grade, ≥99% human, rat pricing
C8503 Cholesterol from sheep wool, ≥92.5% (GC), powder human, rat pricing
C3045 Cholesterol powder, BioReagent, suitable for cell culture, ≥99% human, rat pricing
C3292 Cholesterol ≥95% (GC), powder, Ash, free human, rat pricing
26732 Cholesterol from lanolin, ≥99.0% (GC) human, rat pricing
26740 Cholesterol from lanolin, ≥95.0% (GC) human, rat pricing
14606 Cholesterol tested according to Ph.Eur. human, rat pricing
47127-U Cholesterol solution certified reference material, 10 mg/mL in chloroform human, rat pricing
C1231 Cholesterol, Plant-Derived SyntheChol®, PharmaGrade, USP/NF, Ph Eur, Manufactured under appropriate GMP controls for pharma or biopharmaceutical production human, rat pricing
L6250 Lithocholic acid ≥95% human, rat pricing
S2424 Stigmasterol ~95% human, rat pricing
47132 Stigmasterol certified reference material, 10 mg/mL in chloroform human, rat pricing
S5442 SyntheChol® NS0 Supplement 500 ×, synthetic cholesterol, animal component-free, aqueous solution, sterile-filtered, suitable for cell culture human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001067 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001067 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001067 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011623 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011623 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011623 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001067 Rosetta Predictions human pricing
NM_022183 Rosetta Predictions rat pricing
NM_011623 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001067 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00311873 predicted 1390
2 SASI_Hs01_00042272 predicted 2496
3 SASI_Hs01_00042273 predicted 434
4 SASI_Hs01_00042274 predicted 2179
5 SASI_Hs01_00042275 predicted 2989
6 SASI_Hs01_00042276 predicted 2410
7 SASI_Hs01_00042277 predicted 554
8 SASI_Hs01_00042279 predicted 4692
9 SASI_Hs01_00042280 predicted 294
10 SASI_Hs01_00042281 predicted 1429
11 SASI_Hs01_00042278 predicted 1362
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022183 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00039932 predicted 488
2 SASI_Rn01_00039933 predicted 3121
3 SASI_Rn01_00039934 predicted 4027
4 SASI_Rn02_00262928 predicted 3808
5 SASI_Rn02_00262929 predicted 307
6 SASI_Rn01_00039936 predicted 2131
7 SASI_Rn02_00262930 predicted 1750
8 SASI_Rn01_00039940 predicted 2336
9 SASI_Rn01_00039941 predicted 1226
10 SASI_Rn02_00262931 predicted 915
11 SASI_Rn01_00039935 predicted 3517
12 SASI_Rn01_00039937 predicted 795
13 SASI_Rn01_00039938 predicted 774
14 SASI_Rn01_00039939 predicted 3955
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011623 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00321065 predicted 430
2 SASI_Mm01_00126303 predicted 3933
3 SASI_Mm02_00321066 predicted 613
4 SASI_Mm01_00126304 predicted 563
5 SASI_Mm02_00321067 predicted 2236
6 SASI_Mm01_00126307 predicted 293
7 SASI_Mm02_00321068 predicted 1047
8 SASI_Mm02_00321069 predicted 2011
9 SASI_Mm01_00126310 predicted 973
10 SASI_Mm01_00126311 predicted 4088
11 SASI_Mm01_00126305 predicted 1643
12 SASI_Mm01_00126306 predicted 3179
13 SASI_Mm01_00126308 predicted 793
14 SASI_Mm01_00126309 predicted 821
15 SASI_Mm01_00126312 predicted 3497
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001067
VALIDATED
TOP2A MISSION shRNA Bacterial Glycerol Stock
topoisomerase (DNA) II alpha 170kDa
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000049278    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001067.2-4862s1c1
Sequence:CCGGGCCCAAGTGTTCTTTAGCTTTCTCGAGAAAGCTAAAGAACACTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001067.2-786s1c1
Sequence:CCGGGCCTGATTTGTCTAAGTTTAACTCGAGTTAAACTTAGACAAATCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001067.2-2833s1c1
Sequence:CCGGGCTCCAAATCAATATGTGATTCTCGAGAATCACATATTGATTTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290998    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001067.2-4862s21c1
Sequence:CCGGGCCCAAGTGTTCTTTAGCTTTCTCGAGAAAGCTAAAGAACACTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001067.2-786s21c1
Sequence:CCGGGCCTGATTTGTCTAAGTTTAACTCGAGTTAAACTTAGACAAATCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001067.2-2833s21c1
Sequence:CCGGGCTCCAAATCAATATGTGATTCTCGAGAATCACATATTGATTTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001067.2-1852s21c1
Sequence:CCGGCCCATTGTAAAGGTATCTAAACTCGAGTTTAGATACCTTTACAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001067.2-2182s21c1
Sequence:CCGGTATGGACAAACTACCACATATCTCGAGATATGTGGTAGTTTGTCCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001067
VALIDATED
TOP2A MISSION shRNA shRNA Plasmid DNA
topoisomerase (DNA) II alpha 170kDa
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000049278    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001067.2-4862s1c1
Sequence:CCGGGCCCAAGTGTTCTTTAGCTTTCTCGAGAAAGCTAAAGAACACTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001067.2-786s1c1
Sequence:CCGGGCCTGATTTGTCTAAGTTTAACTCGAGTTAAACTTAGACAAATCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001067.2-2833s1c1
Sequence:CCGGGCTCCAAATCAATATGTGATTCTCGAGAATCACATATTGATTTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290998    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001067.2-4862s21c1
Sequence:CCGGGCCCAAGTGTTCTTTAGCTTTCTCGAGAAAGCTAAAGAACACTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001067.2-786s21c1
Sequence:CCGGGCCTGATTTGTCTAAGTTTAACTCGAGTTAAACTTAGACAAATCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001067.2-2833s21c1
Sequence:CCGGGCTCCAAATCAATATGTGATTCTCGAGAATCACATATTGATTTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001067.2-1852s21c1
Sequence:CCGGCCCATTGTAAAGGTATCTAAACTCGAGTTTAGATACCTTTACAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001067.2-2182s21c1
Sequence:CCGGTATGGACAAACTACCACATATCTCGAGATATGTGGTAGTTTGTCCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001067
VALIDATED
TOP2A MISSION shRNA Lentiviral Transduction Particles
topoisomerase (DNA) II alpha 170kDa
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000049278    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001067.2-4862s1c1
Sequence:CCGGGCCCAAGTGTTCTTTAGCTTTCTCGAGAAAGCTAAAGAACACTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001067.2-786s1c1
Sequence:CCGGGCCTGATTTGTCTAAGTTTAACTCGAGTTAAACTTAGACAAATCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001067.2-2833s1c1
Sequence:CCGGGCTCCAAATCAATATGTGATTCTCGAGAATCACATATTGATTTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290998    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001067.2-4862s21c1
Sequence:CCGGGCCCAAGTGTTCTTTAGCTTTCTCGAGAAAGCTAAAGAACACTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001067.2-786s21c1
Sequence:CCGGGCCTGATTTGTCTAAGTTTAACTCGAGTTAAACTTAGACAAATCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001067.2-2833s21c1
Sequence:CCGGGCTCCAAATCAATATGTGATTCTCGAGAATCACATATTGATTTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001067.2-1852s21c1
Sequence:CCGGCCCATTGTAAAGGTATCTAAACTCGAGTTTAGATACCTTTACAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001067.2-2182s21c1
Sequence:CCGGTATGGACAAACTACCACATATCTCGAGATATGTGGTAGTTTGTCCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011623
VALIDATED
TOP2A MISSION shRNA Bacterial Glycerol Stock
topoisomerase (DNA) II alpha 170kDa
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000070983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011623.1-1823s1c1
Sequence:CCGGCCCGAGTTTGAAGAATGGAAACTCGAGTTTCCATTCTTCAAACTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011623.1-3200s1c1
Sequence:CCGGGCTCGCTTTATATTAGAGAAACTCGAGTTTCTCTAATATAAAGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011623.1-970s1c1
Sequence:CCGGCCAGCAGATTAGCTTCGTCAACTCGAGTTGACGAAGCTAATCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011623.1-3865s1c1
Sequence:CCGGGCAGACTACATTGCCGTTTAACTCGAGTTAAACGGCAATGTAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011623.1-2898s1c1
Sequence:CCGGCCTCTCTAATAACAGACTATACTCGAGTATAGTCTGTTATTAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011623.2-3939s21c1
Sequence:CCGGGCAGACTACATTGCCGTTTAACTCGAGTTAAACGGCAATGTAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011623.2-1897s21c1
Sequence:CCGGCCCGAGTTTGAAGAATGGAAACTCGAGTTTCCATTCTTCAAACTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011623.2-2972s21c1
Sequence:CCGGCCTCTCTAATAACAGACTATACTCGAGTATAGTCTGTTATTAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011623.2-1044s21c1
Sequence:CCGGCCAGCAGATTAGCTTCGTCAACTCGAGTTGACGAAGCTAATCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011623.2-3274s21c1
Sequence:CCGGGCTCGCTTTATATTAGAGAAACTCGAGTTTCTCTAATATAAAGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011623
VALIDATED
TOP2A MISSION shRNA shRNA Plasmid DNA
topoisomerase (DNA) II alpha 170kDa
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000070983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011623.1-1823s1c1
Sequence:CCGGCCCGAGTTTGAAGAATGGAAACTCGAGTTTCCATTCTTCAAACTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011623.1-3200s1c1
Sequence:CCGGGCTCGCTTTATATTAGAGAAACTCGAGTTTCTCTAATATAAAGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011623.1-970s1c1
Sequence:CCGGCCAGCAGATTAGCTTCGTCAACTCGAGTTGACGAAGCTAATCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011623.1-3865s1c1
Sequence:CCGGGCAGACTACATTGCCGTTTAACTCGAGTTAAACGGCAATGTAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011623.1-2898s1c1
Sequence:CCGGCCTCTCTAATAACAGACTATACTCGAGTATAGTCTGTTATTAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011623.2-3939s21c1
Sequence:CCGGGCAGACTACATTGCCGTTTAACTCGAGTTAAACGGCAATGTAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011623.2-1897s21c1
Sequence:CCGGCCCGAGTTTGAAGAATGGAAACTCGAGTTTCCATTCTTCAAACTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011623.2-2972s21c1
Sequence:CCGGCCTCTCTAATAACAGACTATACTCGAGTATAGTCTGTTATTAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011623.2-1044s21c1
Sequence:CCGGCCAGCAGATTAGCTTCGTCAACTCGAGTTGACGAAGCTAATCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011623.2-3274s21c1
Sequence:CCGGGCTCGCTTTATATTAGAGAAACTCGAGTTTCTCTAATATAAAGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011623
VALIDATED
TOP2A MISSION shRNA Lentiviral Transduction Particles
topoisomerase (DNA) II alpha 170kDa
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000070983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011623.1-1823s1c1
Sequence:CCGGCCCGAGTTTGAAGAATGGAAACTCGAGTTTCCATTCTTCAAACTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011623.1-3200s1c1
Sequence:CCGGGCTCGCTTTATATTAGAGAAACTCGAGTTTCTCTAATATAAAGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011623.1-970s1c1
Sequence:CCGGCCAGCAGATTAGCTTCGTCAACTCGAGTTGACGAAGCTAATCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011623.1-3865s1c1
Sequence:CCGGGCAGACTACATTGCCGTTTAACTCGAGTTAAACGGCAATGTAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011623.1-2898s1c1
Sequence:CCGGCCTCTCTAATAACAGACTATACTCGAGTATAGTCTGTTATTAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011623.2-3939s21c1
Sequence:CCGGGCAGACTACATTGCCGTTTAACTCGAGTTAAACGGCAATGTAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011623.2-1897s21c1
Sequence:CCGGCCCGAGTTTGAAGAATGGAAACTCGAGTTTCCATTCTTCAAACTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011623.2-2972s21c1
Sequence:CCGGCCTCTCTAATAACAGACTATACTCGAGTATAGTCTGTTATTAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011623.2-1044s21c1
Sequence:CCGGCCAGCAGATTAGCTTCGTCAACTCGAGTTGACGAAGCTAATCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011623.2-3274s21c1
Sequence:CCGGGCTCGCTTTATATTAGAGAAACTCGAGTTTCTCTAATATAAAGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks