EMAIL THIS PAGE TO A FRIEND

TOP2B

topoisomerase (DNA) II beta 180kDa

Synonyms: TOPIIB top2beta
UniProtKB ID: Q02880, Q13600, Q9UMG8, Q9UQP8
Gene ID:
Human(7155) Summary: This gene encodes a DNA topoisomerase, an enzyme that controls and alters the topologic states of DNA during transcription. This nuclear enzyme is involved in processes such as chromosome condensation, chromatid separation, and the relief of torsional stress that occurs during DNA transcription and replication. It catalyzes the transient breaking and rejoining of two strands of duplex DNA which allows the strands to pass through one another, thus altering the topology of DNA. Two forms of this enzyme exist as likely products of a gene duplication event. The gene encoding this form, beta, is localized to chromosome 3 and the alpha form is localized to chromosome 17. The gene encoding this enzyme functions as the target for several anticancer agents and a variety of mutations in this gene have been associated with the development of drug resistance. Reduced activity of this enzyme may also play a role in ataxia-telangiectasia. Alternative splicing of this gene results in two transcript variants; however, the second variant has not yet been fully described. [provided by RefSeq, Jul 2008]
Mouse(21974) topoisomerase (DNA) II beta
Rat(361100) topoisomerase (DNA) II beta
cow(787256) topoisomerase (DNA) II beta 180kDa
cow(282097) topoisomerase (DNA) II beta 180kDa
sheep(101103037) topoisomerase (DNA) II beta 180kDa
Domestic Rabbit(100351427) topoisomerase (DNA) II beta 180kDa
naked mole-rat(101704972) topoisomerase (DNA) II beta 180kDa
domestic guinea pig(100714821) topoisomerase (DNA) II beta 180kDa
Zebrafish(569877) topoisomerase (DNA) II beta
domestic cat(101088949) topoisomerase (DNA) II beta 180kDa
dog(477044) topoisomerase (DNA) II beta 180kDa
chicken(395966) topoisomerase (DNA) II beta 180kDa
87 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009409 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009409 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009409 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001068 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001068 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001068 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001068 Rosetta Predictions human pricing
XM_001067768 Rosetta Predictions rat pricing
XM_341386 Rosetta Predictions rat pricing
NM_009409 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001068 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00311874 predicted 3717
2 SASI_Hs01_00223166 predicted 829
3 SASI_Hs01_00223168 predicted 3122
4 SASI_Hs01_00223169 predicted 311
5 SASI_Hs01_00223170 predicted 2476
6 SASI_Hs01_00223171 predicted 2633
7 SASI_Hs01_00223172 predicted 1049
8 SASI_Hs01_00223173 predicted 3021
9 SASI_Hs01_00223174 predicted 2734
10 SASI_Hs02_00311875 predicted 341
11 SASI_Hs01_00223165 predicted 2905
12 SASI_Hs01_00223167 predicted 1092
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067768 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00322228 predicted 2741
2 SASI_Rn02_00322229 predicted 3913
3 SASI_Rn02_00322230 predicted 2893
4 SASI_Rn02_00322231 predicted 1218
5 SASI_Rn02_00322232 predicted 2151
6 SASI_Rn02_00322233 predicted 1532
7 SASI_Rn02_00322234 predicted 1313
8 SASI_Rn02_00322235 predicted 1755
9 SASI_Rn02_00322236 predicted 2195
10 SASI_Rn02_00322237 predicted 829
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341386 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00392818 predicted 371
2 SASI_Rn02_00392819 predicted 406
3 SASI_Rn02_00392820 predicted 362
4 SASI_Rn02_00392821 predicted 1156
5 SASI_Rn02_00392822 predicted 893
6 SASI_Rn02_00392823 predicted 209
7 SASI_Rn02_00392824 predicted 581
8 SASI_Rn02_00392825 predicted 808
9 SASI_Rn02_00392826 predicted 1159
10 SASI_Rn02_00392827 predicted 768
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009409 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00064738 predicted 3217
2 SASI_Mm02_00316051 predicted 4987
3 SASI_Mm01_00064739 predicted 4228
4 SASI_Mm01_00064740 predicted 1904
5 SASI_Mm01_00064741 predicted 1505
6 SASI_Mm01_00064742 predicted 2691
7 SASI_Mm01_00064743 predicted 1280
8 SASI_Mm01_00064744 predicted 1728
9 SASI_Mm01_00064745 predicted 2168
10 SASI_Mm01_00064747 predicted 2451
11 SASI_Mm01_00064746 predicted 808
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009409
VALIDATED
TOP2B MISSION shRNA Bacterial Glycerol Stock
topoisomerase (DNA) II beta 180kDa
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000415708    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009409.2-5313s21c1
Sequence:CCGGGTGCCCAAAGAGCACGAACATCTCGAGATGTTCGTGCTCTTTGGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349348    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009409.2-5346s21c1
Sequence:CCGGCCTTGTGTTGTCCTTTGTCTTCTCGAGAAGACAAAGGACAACACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009409.2-1891s21c1
Sequence:CCGGCCGCCAAATCTCTAGCTGTATCTCGAGATACAGCTAGAGATTTGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009409.2-2896s21c1
Sequence:CCGGATGCTGCAAGCCCTCGTTATACTCGAGTATAACGAGGGCTTGCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009409.2-1302s21c1
Sequence:CCGGCGCAGCTATGTAGACCTTTATCTCGAGATAAAGGTCTACATAGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009409.2-2226s21c1
Sequence:CCGGCCCATTGTAAAGGCAAGCAAACTCGAGTTTGCTTGCCTTTACAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009409.2-3939s21c1
Sequence:CCGGACGAAAGGGCGAGAGGTTAATCTCGAGATTAACCTCTCGCCCTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070988    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009409.2-5346s1c1
Sequence:CCGGCCTTGTGTTGTCCTTTGTCTTCTCGAGAAGACAAAGGACAACACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009409.2-1302s1c1
Sequence:CCGGCGCAGCTATGTAGACCTTTATCTCGAGATAAAGGTCTACATAGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009409.2-1891s1c1
Sequence:CCGGCCGCCAAATCTCTAGCTGTATCTCGAGATACAGCTAGAGATTTGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009409.2-3105s1c1
Sequence:CCGGGCTAGAGAAATTGTGAACAATCTCGAGATTGTTCACAATTTCTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009409.2-2226s1c1
Sequence:CCGGCCCATTGTAAAGGCAAGCAAACTCGAGTTTGCTTGCCTTTACAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009409
VALIDATED
TOP2B MISSION shRNA shRNA Plasmid DNA
topoisomerase (DNA) II beta 180kDa
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000415708    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009409.2-5313s21c1
Sequence:CCGGGTGCCCAAAGAGCACGAACATCTCGAGATGTTCGTGCTCTTTGGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349348    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009409.2-5346s21c1
Sequence:CCGGCCTTGTGTTGTCCTTTGTCTTCTCGAGAAGACAAAGGACAACACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009409.2-1891s21c1
Sequence:CCGGCCGCCAAATCTCTAGCTGTATCTCGAGATACAGCTAGAGATTTGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009409.2-2896s21c1
Sequence:CCGGATGCTGCAAGCCCTCGTTATACTCGAGTATAACGAGGGCTTGCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009409.2-1302s21c1
Sequence:CCGGCGCAGCTATGTAGACCTTTATCTCGAGATAAAGGTCTACATAGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009409.2-2226s21c1
Sequence:CCGGCCCATTGTAAAGGCAAGCAAACTCGAGTTTGCTTGCCTTTACAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009409.2-3939s21c1
Sequence:CCGGACGAAAGGGCGAGAGGTTAATCTCGAGATTAACCTCTCGCCCTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070988    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009409.2-5346s1c1
Sequence:CCGGCCTTGTGTTGTCCTTTGTCTTCTCGAGAAGACAAAGGACAACACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009409.2-1302s1c1
Sequence:CCGGCGCAGCTATGTAGACCTTTATCTCGAGATAAAGGTCTACATAGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009409.2-1891s1c1
Sequence:CCGGCCGCCAAATCTCTAGCTGTATCTCGAGATACAGCTAGAGATTTGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009409.2-3105s1c1
Sequence:CCGGGCTAGAGAAATTGTGAACAATCTCGAGATTGTTCACAATTTCTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009409.2-2226s1c1
Sequence:CCGGCCCATTGTAAAGGCAAGCAAACTCGAGTTTGCTTGCCTTTACAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009409
VALIDATED
TOP2B MISSION shRNA Lentiviral Transduction Particles
topoisomerase (DNA) II beta 180kDa
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000415708    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009409.2-5313s21c1
Sequence:CCGGGTGCCCAAAGAGCACGAACATCTCGAGATGTTCGTGCTCTTTGGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349348    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009409.2-5346s21c1
Sequence:CCGGCCTTGTGTTGTCCTTTGTCTTCTCGAGAAGACAAAGGACAACACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009409.2-1891s21c1
Sequence:CCGGCCGCCAAATCTCTAGCTGTATCTCGAGATACAGCTAGAGATTTGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009409.2-2896s21c1
Sequence:CCGGATGCTGCAAGCCCTCGTTATACTCGAGTATAACGAGGGCTTGCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009409.2-1302s21c1
Sequence:CCGGCGCAGCTATGTAGACCTTTATCTCGAGATAAAGGTCTACATAGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009409.2-2226s21c1
Sequence:CCGGCCCATTGTAAAGGCAAGCAAACTCGAGTTTGCTTGCCTTTACAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009409.2-3939s21c1
Sequence:CCGGACGAAAGGGCGAGAGGTTAATCTCGAGATTAACCTCTCGCCCTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070988    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009409.2-5346s1c1
Sequence:CCGGCCTTGTGTTGTCCTTTGTCTTCTCGAGAAGACAAAGGACAACACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009409.2-1302s1c1
Sequence:CCGGCGCAGCTATGTAGACCTTTATCTCGAGATAAAGGTCTACATAGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009409.2-1891s1c1
Sequence:CCGGCCGCCAAATCTCTAGCTGTATCTCGAGATACAGCTAGAGATTTGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009409.2-3105s1c1
Sequence:CCGGGCTAGAGAAATTGTGAACAATCTCGAGATTGTTCACAATTTCTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009409.2-2226s1c1
Sequence:CCGGCCCATTGTAAAGGCAAGCAAACTCGAGTTTGCTTGCCTTTACAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001068
VALIDATED
TOP2B MISSION shRNA Bacterial Glycerol Stock
topoisomerase (DNA) II beta 180kDa
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000233298    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_001068.2-4962s21c1
Sequence:CCGGTGATGATGTAATTGACGGTTTCTCGAGAAACCGTCAATTACATCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_001068.2-2834s21c1
Sequence:CCGGGAACTTGGACACAGGTATATACTCGAGTATATACCTGTGTCCAAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001068.2-2554s21c1
Sequence:CCGGGTAGAGCCTGAGTGGTATATTCTCGAGAATATACCACTCAGGCTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_001068.2-2445s21c1
Sequence:CCGGTGCTGCAAGCCCTCGTTATATCTCGAGATATAACGAGGGCTTGCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_001068.2-849s21c1
Sequence:CCGGTCGCAGTTATGTAGATCTTTACTCGAGTAAAGATCTACATAACTGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001068.2-1825s1c1
Sequence:CCGGCCTGAATTTGACGAATGGAAACTCGAGTTTCCATTCGTCAAATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001068.2-2642s1c1
Sequence:CCGGCCAACTATGATGCTAGGGAAACTCGAGTTTCCCTAGCATCATAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001068.2-325s1c1
Sequence:CCGGGCTGACAATAAACAGAGGGATCTCGAGATCCCTCTGTTTATTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001068.2-4036s1c1
Sequence:CCGGCCTGTGGTTATTCCAAGAGATCTCGAGATCTCTTGGAATAACCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001068.2-1249s1c1
Sequence:CCGGGCAGCCTCTAATTGTGGCATTCTCGAGAATGCCACAATTAGAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001068
VALIDATED
TOP2B MISSION shRNA shRNA Plasmid DNA
topoisomerase (DNA) II beta 180kDa
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000233298    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_001068.2-4962s21c1
Sequence:CCGGTGATGATGTAATTGACGGTTTCTCGAGAAACCGTCAATTACATCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_001068.2-2834s21c1
Sequence:CCGGGAACTTGGACACAGGTATATACTCGAGTATATACCTGTGTCCAAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001068.2-2554s21c1
Sequence:CCGGGTAGAGCCTGAGTGGTATATTCTCGAGAATATACCACTCAGGCTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_001068.2-2445s21c1
Sequence:CCGGTGCTGCAAGCCCTCGTTATATCTCGAGATATAACGAGGGCTTGCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_001068.2-849s21c1
Sequence:CCGGTCGCAGTTATGTAGATCTTTACTCGAGTAAAGATCTACATAACTGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001068.2-1825s1c1
Sequence:CCGGCCTGAATTTGACGAATGGAAACTCGAGTTTCCATTCGTCAAATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001068.2-2642s1c1
Sequence:CCGGCCAACTATGATGCTAGGGAAACTCGAGTTTCCCTAGCATCATAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001068.2-325s1c1
Sequence:CCGGGCTGACAATAAACAGAGGGATCTCGAGATCCCTCTGTTTATTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001068.2-4036s1c1
Sequence:CCGGCCTGTGGTTATTCCAAGAGATCTCGAGATCTCTTGGAATAACCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001068.2-1249s1c1
Sequence:CCGGGCAGCCTCTAATTGTGGCATTCTCGAGAATGCCACAATTAGAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001068
VALIDATED
TOP2B MISSION shRNA Lentiviral Transduction Particles
topoisomerase (DNA) II beta 180kDa
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000233298    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_001068.2-4962s21c1
Sequence:CCGGTGATGATGTAATTGACGGTTTCTCGAGAAACCGTCAATTACATCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_001068.2-2834s21c1
Sequence:CCGGGAACTTGGACACAGGTATATACTCGAGTATATACCTGTGTCCAAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001068.2-2554s21c1
Sequence:CCGGGTAGAGCCTGAGTGGTATATTCTCGAGAATATACCACTCAGGCTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_001068.2-2445s21c1
Sequence:CCGGTGCTGCAAGCCCTCGTTATATCTCGAGATATAACGAGGGCTTGCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_001068.2-849s21c1
Sequence:CCGGTCGCAGTTATGTAGATCTTTACTCGAGTAAAGATCTACATAACTGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001068.2-1825s1c1
Sequence:CCGGCCTGAATTTGACGAATGGAAACTCGAGTTTCCATTCGTCAAATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001068.2-2642s1c1
Sequence:CCGGCCAACTATGATGCTAGGGAAACTCGAGTTTCCCTAGCATCATAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001068.2-325s1c1
Sequence:CCGGGCTGACAATAAACAGAGGGATCTCGAGATCCCTCTGTTTATTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001068.2-4036s1c1
Sequence:CCGGCCTGTGGTTATTCCAAGAGATCTCGAGATCTCTTGGAATAACCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001068.2-1249s1c1
Sequence:CCGGGCAGCCTCTAATTGTGGCATTCTCGAGAATGCCACAATTAGAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks