EMAIL THIS PAGE TO A FRIEND

TOP3A

topoisomerase (DNA) III alpha

Synonyms: TOP3
UniProtKB ID: Q13472, A8KA61, D3DXC7, Q13473
Gene ID:
Human(7156) Summary: This gene encodes a DNA topoisomerase, an enzyme that controls and alters the topologic states of DNA during transcription. This enzyme catalyzes the transient breaking and rejoining of a single strand of DNA which allows the strands to pass through one another, thus reducing the number of supercoils and altering the topology of DNA. This enzyme forms a complex with BLM which functions in the regulation of recombination in somatic cells. [provided by RefSeq, Jul 2008]
Mouse(21975) topoisomerase (DNA) III alpha
Rat(303194) topoisomerase (DNA) III alpha
Thale Cress(836513) topoisomerase 3alpha
domestic cat(101086515) topoisomerase (DNA) III alpha
dog(489537) topoisomerase (DNA) III alpha
chicken(416517) topoisomerase (DNA) III alpha
Zebrafish(560212) topoisomerase (DNA) III alpha
domestic guinea pig(100733021) topoisomerase (DNA) III alpha
naked mole-rat(101706019) topoisomerase (DNA) III alpha
cow(527411) topoisomerase (DNA) III alpha
sheep(101120422) topoisomerase (DNA) III alpha
51 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004618 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004618 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004618 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009410 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009410 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009410 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004618 Rosetta Predictions human pricing
XM_001077625 Rosetta Predictions rat pricing
XM_220527 Rosetta Predictions rat pricing
NM_009410 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004618 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00338013 predicted 975
2 SASI_Hs01_00205088 predicted 1635
3 SASI_Hs01_00205089 predicted 1016
4 SASI_Hs01_00205090 predicted 1504
5 SASI_Hs01_00205092 predicted 2024
6 SASI_Hs01_00205093 predicted 1499
7 SASI_Hs01_00205094 predicted 453
8 SASI_Hs01_00205095 predicted 469
9 SASI_Hs01_00205096 predicted 2201
10 SASI_Hs01_00205097 predicted 815
11 SASI_Hs01_00205091 predicted 1285
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077625 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00357819 predicted 512
2 SASI_Rn02_00357820 predicted 1361
3 SASI_Rn02_00357821 predicted 894
4 SASI_Rn02_00357822 predicted 1456
5 SASI_Rn02_00357823 predicted 2126
6 SASI_Rn02_00357824 predicted 1230
7 SASI_Rn02_00357825 predicted 264
8 SASI_Rn02_00357826 predicted 437
9 SASI_Rn02_00357827 predicted 830
10 SASI_Rn02_00357828 predicted 1055
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_220527 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00188904 predicted 543
2 SASI_Rn01_00188905 predicted 940
3 SASI_Rn01_00188906 predicted 463
4 SASI_Rn01_00188907 predicted 1071
5 SASI_Rn01_00188908 predicted 631
6 SASI_Rn01_00188909 predicted 1731
7 SASI_Rn01_00188910 predicted 841
8 SASI_Rn01_00188911 predicted 409
9 SASI_Rn01_00188912 predicted 986
10 SASI_Rn01_00188913 predicted 1864
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009410 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00148635 predicted 1099
2 SASI_Mm01_00148636 predicted 741
3 SASI_Mm01_00148637 predicted 1202
4 SASI_Mm01_00148638 predicted 2054
5 SASI_Mm01_00148639 predicted 1260
6 SASI_Mm01_00148640 predicted 1111
7 SASI_Mm01_00148641 predicted 501
8 SASI_Mm01_00148642 predicted 1680
9 SASI_Mm01_00148643 predicted 1662
10 SASI_Mm01_00148644 predicted 2612
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004618
VALIDATED
TOP3A MISSION shRNA Bacterial Glycerol Stock
topoisomerase (DNA) III alpha
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000049293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004618.2-1019s1c1
Sequence:CCGGCCAGAAATCTTCCACAGAATTCTCGAGAATTCTGTGGAAGATTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004618.2-1531s1c1
Sequence:CCGGCGAGTTTATTGTTCGCCATTTCTCGAGAAATGGCGAACAATAAACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004618.2-2088s1c1
Sequence:CCGGCGGTGGCTAAAGCAAAGAAATCTCGAGATTTCTTTGCTTTAGCCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004618.2-1235s1c1
Sequence:CCGGGCTTCTCGAAAGTTGAGAATACTCGAGTATTCTCAACTTTCGAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004618.2-465s1c1
Sequence:CCGGGCCAGAATGTTACCATGGTAACTCGAGTTACCATGGTAACATTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004618.3-712s21c1
Sequence:CCGGCCACGTGTGTAAGGCTGTAAACTCGAGTTTACAGCCTTACACACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296836    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004618.3-3674s21c1
Sequence:CCGGTCCTGAGAAGGACGGTGTAATCTCGAGATTACACCGTCCTTCTCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004618.3-1235s21c1
Sequence:CCGGGCTTCTCGAAAGTTGAGAATACTCGAGTATTCTCAACTTTCGAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004618.3-1945s21c1
Sequence:CCGGTGATTCCATGGGCTATGAAATCTCGAGATTTCATAGCCCATGGAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004618.3-487s21c1
Sequence:CCGGGACTTCAGTTTCTGGACATTTCTCGAGAAATGTCCAGAAACTGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004618
VALIDATED
TOP3A MISSION shRNA shRNA Plasmid DNA
topoisomerase (DNA) III alpha
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000049293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004618.2-1019s1c1
Sequence:CCGGCCAGAAATCTTCCACAGAATTCTCGAGAATTCTGTGGAAGATTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004618.2-1531s1c1
Sequence:CCGGCGAGTTTATTGTTCGCCATTTCTCGAGAAATGGCGAACAATAAACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004618.2-2088s1c1
Sequence:CCGGCGGTGGCTAAAGCAAAGAAATCTCGAGATTTCTTTGCTTTAGCCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004618.2-1235s1c1
Sequence:CCGGGCTTCTCGAAAGTTGAGAATACTCGAGTATTCTCAACTTTCGAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004618.2-465s1c1
Sequence:CCGGGCCAGAATGTTACCATGGTAACTCGAGTTACCATGGTAACATTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004618.3-712s21c1
Sequence:CCGGCCACGTGTGTAAGGCTGTAAACTCGAGTTTACAGCCTTACACACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296836    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004618.3-3674s21c1
Sequence:CCGGTCCTGAGAAGGACGGTGTAATCTCGAGATTACACCGTCCTTCTCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004618.3-1235s21c1
Sequence:CCGGGCTTCTCGAAAGTTGAGAATACTCGAGTATTCTCAACTTTCGAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004618.3-1945s21c1
Sequence:CCGGTGATTCCATGGGCTATGAAATCTCGAGATTTCATAGCCCATGGAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004618.3-487s21c1
Sequence:CCGGGACTTCAGTTTCTGGACATTTCTCGAGAAATGTCCAGAAACTGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004618
VALIDATED
TOP3A MISSION shRNA Lentiviral Transduction Particles
topoisomerase (DNA) III alpha
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000049293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004618.2-1019s1c1
Sequence:CCGGCCAGAAATCTTCCACAGAATTCTCGAGAATTCTGTGGAAGATTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004618.2-1531s1c1
Sequence:CCGGCGAGTTTATTGTTCGCCATTTCTCGAGAAATGGCGAACAATAAACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004618.2-2088s1c1
Sequence:CCGGCGGTGGCTAAAGCAAAGAAATCTCGAGATTTCTTTGCTTTAGCCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004618.2-1235s1c1
Sequence:CCGGGCTTCTCGAAAGTTGAGAATACTCGAGTATTCTCAACTTTCGAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004618.2-465s1c1
Sequence:CCGGGCCAGAATGTTACCATGGTAACTCGAGTTACCATGGTAACATTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004618.3-712s21c1
Sequence:CCGGCCACGTGTGTAAGGCTGTAAACTCGAGTTTACAGCCTTACACACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296836    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004618.3-3674s21c1
Sequence:CCGGTCCTGAGAAGGACGGTGTAATCTCGAGATTACACCGTCCTTCTCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004618.3-1235s21c1
Sequence:CCGGGCTTCTCGAAAGTTGAGAATACTCGAGTATTCTCAACTTTCGAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004618.3-1945s21c1
Sequence:CCGGTGATTCCATGGGCTATGAAATCTCGAGATTTCATAGCCCATGGAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004618.3-487s21c1
Sequence:CCGGGACTTCAGTTTCTGGACATTTCTCGAGAAATGTCCAGAAACTGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009410
TOP3A MISSION shRNA Bacterial Glycerol Stock
topoisomerase (DNA) III alpha
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009410.1-735s1c1
Sequence:CCGGGCTTTGAGATTATCCACGTATCTCGAGATACGTGGATAATCTCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009410.1-2608s1c1
Sequence:CCGGCCTGTCTCAACCTCTGGTTAACTCGAGTTAACCAGAGGTTGAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070998    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009410.1-3510s1c1
Sequence:CCGGGCAGTCAGCATGTAAGCAGAACTCGAGTTCTGCTTACATGCTGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009410.1-501s1c1
Sequence:CCGGGCCAGAATGTTACTATGATAACTCGAGTTATCATAGTAACATTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009410.1-1567s1c1
Sequence:CCGGCGAGTTCATTGTTCGCCATTTCTCGAGAAATGGCGAACAATGAACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009410
TOP3A MISSION shRNA shRNA Plasmid DNA
topoisomerase (DNA) III alpha
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009410.1-735s1c1
Sequence:CCGGGCTTTGAGATTATCCACGTATCTCGAGATACGTGGATAATCTCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009410.1-2608s1c1
Sequence:CCGGCCTGTCTCAACCTCTGGTTAACTCGAGTTAACCAGAGGTTGAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070998    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009410.1-3510s1c1
Sequence:CCGGGCAGTCAGCATGTAAGCAGAACTCGAGTTCTGCTTACATGCTGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009410.1-501s1c1
Sequence:CCGGGCCAGAATGTTACTATGATAACTCGAGTTATCATAGTAACATTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009410.1-1567s1c1
Sequence:CCGGCGAGTTCATTGTTCGCCATTTCTCGAGAAATGGCGAACAATGAACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009410
TOP3A MISSION shRNA Lentiviral Transduction Particles
topoisomerase (DNA) III alpha
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009410.1-735s1c1
Sequence:CCGGGCTTTGAGATTATCCACGTATCTCGAGATACGTGGATAATCTCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009410.1-2608s1c1
Sequence:CCGGCCTGTCTCAACCTCTGGTTAACTCGAGTTAACCAGAGGTTGAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070998    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009410.1-3510s1c1
Sequence:CCGGGCAGTCAGCATGTAAGCAGAACTCGAGTTCTGCTTACATGCTGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009410.1-501s1c1
Sequence:CCGGGCCAGAATGTTACTATGATAACTCGAGTTATCATAGTAACATTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009410.1-1567s1c1
Sequence:CCGGCGAGTTCATTGTTCGCCATTTCTCGAGAAATGGCGAACAATGAACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks