EMAIL THIS PAGE TO A FRIEND

TOP3B

topoisomerase (DNA) III beta

Synonyms: TOP3B1
UniProtKB ID: O95985, A0M8Q3, Q9BUP5
Gene ID:
Human(8940) Summary: This gene encodes a DNA topoisomerase, an enzyme that controls and alters the topologic states of DNA during transcription. This enzyme catalyzes the transient breaking and rejoining of a single strand of DNA which allows the strands to pass through one another, thus relaxing the supercoils and altering the topology of DNA. The enzyme interacts with DNA helicase SGS1 and plays a role in DNA recombination, cellular aging and maintenance of genome stability. Alternative splicing of the C-terminus of this gene results in three transcript variants which have distinct tissue specificity; however, not all variants have been fully described. [provided by RefSeq, Jul 2008]
Mouse(21976) topoisomerase (DNA) III beta
Rat(287930) topoisomerase (DNA) III beta
chicken(416771) topoisomerase (DNA) III beta
Horse(100051153) topoisomerase (DNA) III beta
domestic cat(101088117) topoisomerase (DNA) III beta
dog(477576) topoisomerase (DNA) III beta
cow(537418) topoisomerase (DNA) III beta
sheep(101114728) topoisomerase (DNA) III beta
naked mole-rat(101708161) topoisomerase (DNA) III beta
Domestic Rabbit(100345272) topoisomerase (DNA) III beta
domestic guinea pig(100734860) topoisomerase (DNA) III beta
55 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003935 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003935 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003935 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011624 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011624 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011624 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003935 Rosetta Predictions human pricing
NM_001105861 Rosetta Predictions rat pricing
NM_011624 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003935 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00224915 predicted 821
2 SASI_Hs02_00336582 predicted 1926
3 SASI_Hs01_00224916 predicted 1180
4 SASI_Hs01_00224917 predicted 1006
5 SASI_Hs01_00224918 predicted 583
6 SASI_Hs01_00224920 predicted 2208
7 SASI_Hs01_00224921 predicted 1129
8 SASI_Hs01_00224922 predicted 996
9 SASI_Hs01_00224923 predicted 882
10 SASI_Hs01_00224924 predicted 1172
11 SASI_Hs01_00224919 predicted 1470
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105861 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00213252 predicted 2035
2 SASI_Rn02_00213253 predicted 1622
3 SASI_Rn02_00213254 predicted 2078
4 SASI_Rn02_00213255 predicted 2501
5 SASI_Rn02_00213256 predicted 1226
6 SASI_Rn02_00213257 predicted 485
7 SASI_Rn02_00213258 predicted 439
8 SASI_Rn02_00213259 predicted 1275
9 SASI_Rn02_00213260 predicted 933
10 SASI_Rn02_00213261 predicted 1364
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011624 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00087668 predicted 2331
2 SASI_Mm01_00087669 predicted 1638
3 SASI_Mm01_00087670 predicted 745
4 SASI_Mm01_00087671 predicted 890
5 SASI_Mm02_00321070 predicted 846
6 SASI_Mm01_00087672 predicted 714
7 SASI_Mm01_00087673 predicted 973
8 SASI_Mm01_00087674 predicted 2056
9 SASI_Mm01_00087675 predicted 2089
10 SASI_Mm01_00087677 predicted 953
11 SASI_Mm01_00087676 predicted 2524
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003935
TOP3B MISSION shRNA Bacterial Glycerol Stock
topoisomerase (DNA) III beta
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003935.3-1529s21c1
Sequence:CCGGACACGGTGAAGCGGTTGTTAGCTCGAGCTAACAACCGCTTCACCGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003935.3-2216s21c1
Sequence:CCGGACTACTTTGTCGACTCCATTGCTCGAGCAATGGAGTCGACAAAGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003935.3-1467s1c1
Sequence:CCGGCCCTGAGAACTTTGACCTGAACTCGAGTTCAGGTCAAAGTTCTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003935.3-1168s1c1
Sequence:CCGGGCCAAGGTTAACACTGACAAACTCGAGTTTGTCAGTGTTAACCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003935.3-2526s1c1
Sequence:CCGGCCGAGACATGAAGAAAGGCATCTCGAGATGCCTTTCTTCATGTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003935.3-1977s1c1
Sequence:CCGGCCCTGTGCATATCAACAACATCTCGAGATGTTGTTGATATGCACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003935
TOP3B MISSION shRNA shRNA Plasmid DNA
topoisomerase (DNA) III beta
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003935.3-1529s21c1
Sequence:CCGGACACGGTGAAGCGGTTGTTAGCTCGAGCTAACAACCGCTTCACCGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003935.3-2216s21c1
Sequence:CCGGACTACTTTGTCGACTCCATTGCTCGAGCAATGGAGTCGACAAAGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003935.3-1467s1c1
Sequence:CCGGCCCTGAGAACTTTGACCTGAACTCGAGTTCAGGTCAAAGTTCTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003935.3-1168s1c1
Sequence:CCGGGCCAAGGTTAACACTGACAAACTCGAGTTTGTCAGTGTTAACCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003935.3-2526s1c1
Sequence:CCGGCCGAGACATGAAGAAAGGCATCTCGAGATGCCTTTCTTCATGTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003935.3-1977s1c1
Sequence:CCGGCCCTGTGCATATCAACAACATCTCGAGATGTTGTTGATATGCACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003935
TOP3B MISSION shRNA Lentiviral Transduction Particles
topoisomerase (DNA) III beta
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003935.3-1529s21c1
Sequence:CCGGACACGGTGAAGCGGTTGTTAGCTCGAGCTAACAACCGCTTCACCGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003935.3-2216s21c1
Sequence:CCGGACTACTTTGTCGACTCCATTGCTCGAGCAATGGAGTCGACAAAGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003935.3-1467s1c1
Sequence:CCGGCCCTGAGAACTTTGACCTGAACTCGAGTTCAGGTCAAAGTTCTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003935.3-1168s1c1
Sequence:CCGGGCCAAGGTTAACACTGACAAACTCGAGTTTGTCAGTGTTAACCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003935.3-2526s1c1
Sequence:CCGGCCGAGACATGAAGAAAGGCATCTCGAGATGCCTTTCTTCATGTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003935.3-1977s1c1
Sequence:CCGGCCCTGTGCATATCAACAACATCTCGAGATGTTGTTGATATGCACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011624
VALIDATED
TOP3B MISSION shRNA Bacterial Glycerol Stock
topoisomerase (DNA) III beta
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000375850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011624.2-1839s21c1
Sequence:CCGGATATCTGCCAGCGCAACTATGCTCGAGCATAGTTGCGCTGGCAGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011624.2-1494s21c1
Sequence:CCGGCATGGAGACTCTACGAGTATACTCGAGTATACTCGTAGAGTCTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011624.2-2338s21c1
Sequence:CCGGACTATGTCCCTACTGCTATAACTCGAGTTATAGCAGTAGGGACATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011624.2-2152s21c1
Sequence:CCGGTGGGAAGTGCCATCGATTTATCTCGAGATAAATCGATGGCACTTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011624.2-1262s21c1
Sequence:CCGGTTATACACACAGGGCTATATCCTCGAGGATATAGCCCTGTGTGTATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011624.2-2454s21c1
Sequence:CCGGAGTGCGTGGAATGCGAGAATGCTCGAGCATTCTCGCATTCCACGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011624.2-1364s21c1
Sequence:CCGGTACTGGGCAGACTCGGTAAAGCTCGAGCTTTACCGAGTCTGCCCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011624.2-1507s1c1
Sequence:CCGGCGAGTATATCACCAGACACTTCTCGAGAAGTGTCTGGTGATATACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011624.2-2059s1c1
Sequence:CCGGCCACTACTTCGTTGATTCTATCTCGAGATAGAATCAACGAAGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011624.2-394s1c1
Sequence:CCGGGCACAAGTACACAGGAACCTTCTCGAGAAGGTTCCTGTGTACTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011624.2-1013s1c1
Sequence:CCGGGCCAAGGTTCATACAGATAAACTCGAGTTTATCTGTATGAACCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011624.2-2161s1c1
Sequence:CCGGCCATCGATTTATGAAGTACATCTCGAGATGTACTTCATAAATCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011624
VALIDATED
TOP3B MISSION shRNA shRNA Plasmid DNA
topoisomerase (DNA) III beta
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000375850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011624.2-1839s21c1
Sequence:CCGGATATCTGCCAGCGCAACTATGCTCGAGCATAGTTGCGCTGGCAGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011624.2-1494s21c1
Sequence:CCGGCATGGAGACTCTACGAGTATACTCGAGTATACTCGTAGAGTCTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011624.2-2338s21c1
Sequence:CCGGACTATGTCCCTACTGCTATAACTCGAGTTATAGCAGTAGGGACATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011624.2-2152s21c1
Sequence:CCGGTGGGAAGTGCCATCGATTTATCTCGAGATAAATCGATGGCACTTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011624.2-1262s21c1
Sequence:CCGGTTATACACACAGGGCTATATCCTCGAGGATATAGCCCTGTGTGTATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011624.2-2454s21c1
Sequence:CCGGAGTGCGTGGAATGCGAGAATGCTCGAGCATTCTCGCATTCCACGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011624.2-1364s21c1
Sequence:CCGGTACTGGGCAGACTCGGTAAAGCTCGAGCTTTACCGAGTCTGCCCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011624.2-1507s1c1
Sequence:CCGGCGAGTATATCACCAGACACTTCTCGAGAAGTGTCTGGTGATATACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011624.2-2059s1c1
Sequence:CCGGCCACTACTTCGTTGATTCTATCTCGAGATAGAATCAACGAAGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011624.2-394s1c1
Sequence:CCGGGCACAAGTACACAGGAACCTTCTCGAGAAGGTTCCTGTGTACTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011624.2-1013s1c1
Sequence:CCGGGCCAAGGTTCATACAGATAAACTCGAGTTTATCTGTATGAACCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011624.2-2161s1c1
Sequence:CCGGCCATCGATTTATGAAGTACATCTCGAGATGTACTTCATAAATCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011624
VALIDATED
TOP3B MISSION shRNA Lentiviral Transduction Particles
topoisomerase (DNA) III beta
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000375850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011624.2-1839s21c1
Sequence:CCGGATATCTGCCAGCGCAACTATGCTCGAGCATAGTTGCGCTGGCAGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011624.2-1494s21c1
Sequence:CCGGCATGGAGACTCTACGAGTATACTCGAGTATACTCGTAGAGTCTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011624.2-2338s21c1
Sequence:CCGGACTATGTCCCTACTGCTATAACTCGAGTTATAGCAGTAGGGACATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011624.2-2152s21c1
Sequence:CCGGTGGGAAGTGCCATCGATTTATCTCGAGATAAATCGATGGCACTTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011624.2-1262s21c1
Sequence:CCGGTTATACACACAGGGCTATATCCTCGAGGATATAGCCCTGTGTGTATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011624.2-2454s21c1
Sequence:CCGGAGTGCGTGGAATGCGAGAATGCTCGAGCATTCTCGCATTCCACGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011624.2-1364s21c1
Sequence:CCGGTACTGGGCAGACTCGGTAAAGCTCGAGCTTTACCGAGTCTGCCCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011624.2-1507s1c1
Sequence:CCGGCGAGTATATCACCAGACACTTCTCGAGAAGTGTCTGGTGATATACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011624.2-2059s1c1
Sequence:CCGGCCACTACTTCGTTGATTCTATCTCGAGATAGAATCAACGAAGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011624.2-394s1c1
Sequence:CCGGGCACAAGTACACAGGAACCTTCTCGAGAAGGTTCCTGTGTACTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011624.2-1013s1c1
Sequence:CCGGGCCAAGGTTCATACAGATAAACTCGAGTTTATCTGTATGAACCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011624.2-2161s1c1
Sequence:CCGGCCATCGATTTATGAAGTACATCTCGAGATGTACTTCATAAATCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks