EMAIL THIS PAGE TO A FRIEND

TOPAZ1

testis and ovary specific PAZ domain containing 1

Synonyms: C3orf77
UniProtKB ID: Q8N9V7
Gene ID:
Mouse(671232) testis and ovary specific PAZ domain containing 1
Rat(301075) testis and ovary specific PAZ domain containing 1
chicken(100857244) testis and ovary specific PAZ domain containing 1
domestic cat(101100663) testis and ovary specific PAZ domain containing 1
domestic guinea pig(100714428) testis and ovary specific PAZ domain containing 1
cow(100296400) testis and ovary specific PAZ domain containing 1
sheep(100528008) testis and ovary specific PAZ domain containing 1
82 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001145030 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001145030 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001145030 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001724962 Rosetta Predictions human pricing
XM_371632 Rosetta Predictions human pricing
XM_941032 Rosetta Predictions human pricing
XM_001078368 Rosetta Predictions rat pricing
XM_238565 Rosetta Predictions rat pricing
XM_001474362 Rosetta Predictions mouse pricing
XM_001477413 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001724962 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00464626 predicted 3688
2 SASI_Hs02_00464627 predicted 2385
3 SASI_Hs02_00464628 predicted 1528
4 SASI_Hs02_00464629 predicted 4702
5 SASI_Hs02_00464630 predicted 1620
6 SASI_Hs02_00464631 predicted 3273
7 SASI_Hs02_00464632 predicted 2410
8 SASI_Hs02_00464633 predicted 4995
9 SASI_Hs02_00464634 predicted 4908
10 SASI_Hs02_00464635 predicted 960
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_371632 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00295629 predicted 3688
2 SASI_Hs01_00295630 predicted 2390
3 SASI_Hs01_00295632 predicted 1527
4 SASI_Hs01_00295633 predicted 4699
5 SASI_Hs01_00295634 predicted 1614
6 SASI_Hs01_00295635 predicted 3276
7 SASI_Hs02_00479337 predicted 2418
8 SASI_Hs01_00295636 predicted 5000
9 SASI_Hs01_00295637 predicted 4906
10 SASI_Hs02_00479338 predicted 954
11 SASI_Hs01_00295631 predicted 4501
12 SASI_Hs01_00295638 predicted 3785
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_941032 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00484569 predicted 3692
2 SASI_Hs02_00484570 predicted 2388
3 SASI_Hs02_00484571 predicted 1534
4 SASI_Hs02_00484572 predicted 4695
5 SASI_Hs02_00484573 predicted 1615
6 SASI_Hs02_00484574 predicted 3277
7 SASI_Hs02_00484575 predicted 2409
8 SASI_Hs02_00484576 predicted 4995
9 SASI_Hs02_00484577 predicted 4907
10 SASI_Hs02_00484578 predicted 959
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078368 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00360544 predicted 1200
2 SASI_Rn02_00360545 predicted 992
3 SASI_Rn02_00360546 predicted 2342
4 SASI_Rn02_00360547 predicted 2155
5 SASI_Rn02_00360548 predicted 1263
6 SASI_Rn02_00360549 predicted 703
7 SASI_Rn02_00360550 predicted 1083
8 SASI_Rn02_00360551 predicted 2137
9 SASI_Rn02_00360552 predicted 280
10 SASI_Rn02_00360553 predicted 1223
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_238565 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00391436 predicted 229
2 SASI_Rn02_00391437 predicted 230
3 SASI_Rn02_00391438 predicted 207
4 SASI_Rn02_00391439 predicted 314
5 SASI_Rn02_00391440 predicted 231
6 SASI_Rn02_00391441 predicted 234
7 SASI_Rn02_00391442 predicted 266
8 SASI_Rn02_00391443 predicted 285
9 SASI_Rn02_00391444 predicted 266
10 SASI_Rn02_00391445 predicted 309
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001474362 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00374817 predicted 1205
2 SASI_Mm02_00374818 predicted 233
3 SASI_Mm02_00374819 predicted 850
4 SASI_Mm02_00374820 predicted 598
5 SASI_Mm02_00374821 predicted 1147
6 SASI_Mm02_00374822 predicted 909
7 SASI_Mm02_00374823 predicted 235
8 SASI_Mm02_00374824 predicted 393
9 SASI_Mm02_00374825 predicted 816
10 SASI_Mm02_00374826 predicted 1196
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001477413 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00395734 predicted 1209
2 SASI_Mm02_00395735 predicted 236
3 SASI_Mm02_00395736 predicted 852
4 SASI_Mm02_00395737 predicted 594
5 SASI_Mm02_00395738 predicted 1150
6 SASI_Mm02_00395739 predicted 907
7 SASI_Mm02_00395740 predicted 239
8 SASI_Mm02_00395741 predicted 386
9 SASI_Mm02_00395742 predicted 811
10 SASI_Mm02_00395743 predicted 1195
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001145030
TOPAZ1 MISSION shRNA Bacterial Glycerol Stock
testis and ovary specific PAZ domain containing 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000336655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145030.1-1535s21c1
Sequence:CCGGCACCTAATGAGTACCATATTGCTCGAGCAATATGGTACTCATTAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145030.1-4960s21c1
Sequence:CCGGGTATCTAATGCTAGTAGTATTCTCGAGAATACTACTAGCATTAGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145030.1-1903s21c1
Sequence:CCGGGAACCTACTTTAATGGTTATACTCGAGTATAACCATTAAAGTAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145030.1-3434s21c1
Sequence:CCGGGGTTGATGATACCCTATAAATCTCGAGATTTATAGGGTATCATCAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145030.1-2003s21c1
Sequence:CCGGCTACTGAAGATACTCAATTAACTCGAGTTAATTGAGTATCTTCAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001145030
TOPAZ1 MISSION shRNA shRNA Plasmid DNA
testis and ovary specific PAZ domain containing 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000336655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145030.1-1535s21c1
Sequence:CCGGCACCTAATGAGTACCATATTGCTCGAGCAATATGGTACTCATTAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145030.1-4960s21c1
Sequence:CCGGGTATCTAATGCTAGTAGTATTCTCGAGAATACTACTAGCATTAGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145030.1-1903s21c1
Sequence:CCGGGAACCTACTTTAATGGTTATACTCGAGTATAACCATTAAAGTAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145030.1-3434s21c1
Sequence:CCGGGGTTGATGATACCCTATAAATCTCGAGATTTATAGGGTATCATCAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145030.1-2003s21c1
Sequence:CCGGCTACTGAAGATACTCAATTAACTCGAGTTAATTGAGTATCTTCAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001145030
TOPAZ1 MISSION shRNA Lentiviral Transduction Particles
testis and ovary specific PAZ domain containing 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000336655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145030.1-1535s21c1
Sequence:CCGGCACCTAATGAGTACCATATTGCTCGAGCAATATGGTACTCATTAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145030.1-4960s21c1
Sequence:CCGGGTATCTAATGCTAGTAGTATTCTCGAGAATACTACTAGCATTAGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145030.1-1903s21c1
Sequence:CCGGGAACCTACTTTAATGGTTATACTCGAGTATAACCATTAAAGTAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145030.1-3434s21c1
Sequence:CCGGGGTTGATGATACCCTATAAATCTCGAGATTTATAGGGTATCATCAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145030.1-2003s21c1
Sequence:CCGGCTACTGAAGATACTCAATTAACTCGAGTTAATTGAGTATCTTCAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks