EMAIL THIS PAGE TO A FRIEND

TOPBP1

topoisomerase (DNA) II binding protein 1

Synonyms: TOP2BP1
UniProtKB ID: Q92547, B7Z7W8, Q7LGC1, Q9UEB9
Gene ID:
Human(11073) Summary: This gene encodes a binding protein which interacts with the C-terminal region of topoisomerase II beta. This interaction suggests a supportive role for this protein in the catalytic reactions of topoisomerase II beta through transient breakages of DNA strands. [provided by RefSeq, Jul 2008]
Mouse(235559) topoisomerase (DNA) II binding protein 1
Rat(315969) topoisomerase (DNA) II binding protein 1
cow(540574) topoisomerase (DNA) II binding protein 1
sheep(101117384) topoisomerase (DNA) II binding protein 1
domestic guinea pig(100721641) topoisomerase (DNA) II binding protein 1
Domestic Rabbit(100349197) topoisomerase (DNA) II binding protein 1
naked mole-rat(101717100) topoisomerase (DNA) II binding protein 1
Zebrafish(407679) topoisomerase (DNA) II binding protein 1
chicken(420694) topoisomerase (DNA) II binding protein 1
Horse(100053011) topoisomerase (DNA) II binding protein 1
domestic cat(101085568) topoisomerase (DNA) II binding protein 1
dog(477070) topoisomerase (DNA) II binding protein 1
92 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007027 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007027 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007027 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_176979 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_176979 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_176979 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007027 Rosetta Predictions human pricing
XM_001072207 Rosetta Predictions rat pricing
XM_236578 Rosetta Predictions rat pricing
NM_176979 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007027 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00342794 predicted 2930
2 SASI_Hs01_00132254 predicted 2528
3 SASI_Hs01_00132255 predicted 4644
4 SASI_Hs01_00132256 predicted 4713
5 SASI_Hs01_00132259 predicted 1344
6 SASI_Hs02_00342795 predicted 556
7 SASI_Hs01_00132261 predicted 2718
8 SASI_Hs02_00342796 predicted 3095
9 SASI_Hs01_00132262 predicted 1171
10 SASI_Hs01_00132263 predicted 3247
11 SASI_Hs01_00132257 predicted 1366
12 SASI_Hs01_00132258 predicted 4574
13 SASI_Hs01_00132260 predicted 3848
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072207 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00338211 predicted 445
2 SASI_Rn02_00338212 predicted 2386
3 SASI_Rn02_00338213 predicted 3087
4 SASI_Rn02_00338214 predicted 2373
5 SASI_Rn02_00338215 predicted 4593
6 SASI_Rn02_00338216 predicted 543
7 SASI_Rn02_00338217 predicted 2589
8 SASI_Rn02_00338218 predicted 2393
9 SASI_Rn02_00338219 predicted 4798
10 SASI_Rn02_00338220 predicted 528
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_236578 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00390159 predicted 444
2 SASI_Rn02_00390160 predicted 2377
3 SASI_Rn02_00390161 predicted 3082
4 SASI_Rn02_00390162 predicted 2367
5 SASI_Rn02_00390163 predicted 4592
6 SASI_Rn02_00390164 predicted 539
7 SASI_Rn02_00390165 predicted 2589
8 SASI_Rn02_00390166 predicted 2394
9 SASI_Rn02_00390167 predicted 4803
10 SASI_Rn02_00390168 predicted 530
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176979 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00027853 predicted 4089
2 SASI_Mm01_00027854 predicted 1362
3 SASI_Mm01_00027855 predicted 2195
4 SASI_Mm01_00027856 predicted 1201
5 SASI_Mm01_00027857 predicted 2793
6 SASI_Mm01_00027858 predicted 370
7 SASI_Mm01_00027859 predicted 1162
8 SASI_Mm01_00027860 predicted 2900
9 SASI_Mm02_00346898 predicted 1035
10 SASI_Mm01_00027862 predicted 3997
11 SASI_Mm01_00027861 predicted 3075
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007027
VALIDATED
TOPBP1 MISSION shRNA Bacterial Glycerol Stock
topoisomerase (DNA) II binding protein 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000369629    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_007027.3-4768s21c1
Sequence:CCGGGATAGATTTGGGTAGTAATTTCTCGAGAAATTACTACCCAAATCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_007027.3-2251s21c1
Sequence:CCGGGCTGCAAAGAAGTGGAATTTACTCGAGTAAATTCCACTTCTTTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_007027.3-1103s21c1
Sequence:CCGGGCGTAAGTGAATCAATATGTACTCGAGTACATATTGATTCACTTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_007027.3-2459s21c1
Sequence:CCGGCCGTCGTTACACCTTTAGATACTCGAGTATCTAAAGGTGTAACGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_007027.3-1663s21c1
Sequence:CCGGCCCTTTAATGATTCTACTCATCTCGAGATGAGTAGAATCATTAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007027.2-3574s1c1
Sequence:CCGGGCCTAGTTGTCCCACACAATACTCGAGTATTGTGTGGGACAACTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_007027.2-1616s1c1
Sequence:CCGGCCCTTTAATGATTCTACTCATCTCGAGATGAGTAGAATCATTAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_007027.2-1056s1c1
Sequence:CCGGGCGTAAGTGAATCAATATGTACTCGAGTACATATTGATTCACTTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_007027.2-2204s1c1
Sequence:CCGGGCTGCAAAGAAGTGGAATTTACTCGAGTAAATTCCACTTCTTTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_007027.2-2412s1c1
Sequence:CCGGCCGTCGTTACACCTTTAGATACTCGAGTATCTAAAGGTGTAACGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007027
VALIDATED
TOPBP1 MISSION shRNA shRNA Plasmid DNA
topoisomerase (DNA) II binding protein 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000369629    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_007027.3-4768s21c1
Sequence:CCGGGATAGATTTGGGTAGTAATTTCTCGAGAAATTACTACCCAAATCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_007027.3-2251s21c1
Sequence:CCGGGCTGCAAAGAAGTGGAATTTACTCGAGTAAATTCCACTTCTTTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_007027.3-1103s21c1
Sequence:CCGGGCGTAAGTGAATCAATATGTACTCGAGTACATATTGATTCACTTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_007027.3-2459s21c1
Sequence:CCGGCCGTCGTTACACCTTTAGATACTCGAGTATCTAAAGGTGTAACGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_007027.3-1663s21c1
Sequence:CCGGCCCTTTAATGATTCTACTCATCTCGAGATGAGTAGAATCATTAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007027.2-3574s1c1
Sequence:CCGGGCCTAGTTGTCCCACACAATACTCGAGTATTGTGTGGGACAACTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_007027.2-1616s1c1
Sequence:CCGGCCCTTTAATGATTCTACTCATCTCGAGATGAGTAGAATCATTAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_007027.2-1056s1c1
Sequence:CCGGGCGTAAGTGAATCAATATGTACTCGAGTACATATTGATTCACTTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_007027.2-2204s1c1
Sequence:CCGGGCTGCAAAGAAGTGGAATTTACTCGAGTAAATTCCACTTCTTTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_007027.2-2412s1c1
Sequence:CCGGCCGTCGTTACACCTTTAGATACTCGAGTATCTAAAGGTGTAACGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007027
VALIDATED
TOPBP1 MISSION shRNA Lentiviral Transduction Particles
topoisomerase (DNA) II binding protein 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000369629    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_007027.3-4768s21c1
Sequence:CCGGGATAGATTTGGGTAGTAATTTCTCGAGAAATTACTACCCAAATCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_007027.3-2251s21c1
Sequence:CCGGGCTGCAAAGAAGTGGAATTTACTCGAGTAAATTCCACTTCTTTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_007027.3-1103s21c1
Sequence:CCGGGCGTAAGTGAATCAATATGTACTCGAGTACATATTGATTCACTTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_007027.3-2459s21c1
Sequence:CCGGCCGTCGTTACACCTTTAGATACTCGAGTATCTAAAGGTGTAACGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_007027.3-1663s21c1
Sequence:CCGGCCCTTTAATGATTCTACTCATCTCGAGATGAGTAGAATCATTAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007027.2-3574s1c1
Sequence:CCGGGCCTAGTTGTCCCACACAATACTCGAGTATTGTGTGGGACAACTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_007027.2-1616s1c1
Sequence:CCGGCCCTTTAATGATTCTACTCATCTCGAGATGAGTAGAATCATTAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_007027.2-1056s1c1
Sequence:CCGGGCGTAAGTGAATCAATATGTACTCGAGTACATATTGATTCACTTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_007027.2-2204s1c1
Sequence:CCGGGCTGCAAAGAAGTGGAATTTACTCGAGTAAATTCCACTTCTTTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_007027.2-2412s1c1
Sequence:CCGGCCGTCGTTACACCTTTAGATACTCGAGTATCTAAAGGTGTAACGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_176979
VALIDATED
TOPBP1 MISSION shRNA Bacterial Glycerol Stock
topoisomerase (DNA) II binding protein 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000302500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176979.5-220s21c1
Sequence:CCGGGCTTTATATCTGTGACCGTTTCTCGAGAAACGGTCACAGATATAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302499    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176979.5-4793s21c1
Sequence:CCGGCCTGAATTTGAATCACTGGTTCTCGAGAACCAGTGATTCAAATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176979.5-2221s21c1
Sequence:CCGGGCTCTTAGAAACTGCGAGAATCTCGAGATTCTCGCAGTTTCTAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176979.5-1722s21c1
Sequence:CCGGGCCAGAAGAGTTTCCTTGTTTCTCGAGAAACAAGGAAACTCTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124219    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_176979.4-4793s1c1
Sequence:CCGGCCTGAATTTGAATCACTGGTTCTCGAGAACCAGTGATTCAAATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_176979.4-2221s1c1
Sequence:CCGGGCTCTTAGAAACTGCGAGAATCTCGAGATTCTCGCAGTTTCTAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176979.4-220s1c1
Sequence:CCGGGCTTTATATCTGTGACCGTTTCTCGAGAAACGGTCACAGATATAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_176979.4-1722s1c1
Sequence:CCGGGCCAGAAGAGTTTCCTTGTTTCTCGAGAAACAAGGAAACTCTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_176979.4-219s1c1
Sequence:CCGGCGCTTTATATCTGTGACCGTTCTCGAGAACGGTCACAGATATAAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_176979
VALIDATED
TOPBP1 MISSION shRNA shRNA Plasmid DNA
topoisomerase (DNA) II binding protein 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000302500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176979.5-220s21c1
Sequence:CCGGGCTTTATATCTGTGACCGTTTCTCGAGAAACGGTCACAGATATAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302499    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176979.5-4793s21c1
Sequence:CCGGCCTGAATTTGAATCACTGGTTCTCGAGAACCAGTGATTCAAATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176979.5-2221s21c1
Sequence:CCGGGCTCTTAGAAACTGCGAGAATCTCGAGATTCTCGCAGTTTCTAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176979.5-1722s21c1
Sequence:CCGGGCCAGAAGAGTTTCCTTGTTTCTCGAGAAACAAGGAAACTCTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124219    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_176979.4-4793s1c1
Sequence:CCGGCCTGAATTTGAATCACTGGTTCTCGAGAACCAGTGATTCAAATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_176979.4-2221s1c1
Sequence:CCGGGCTCTTAGAAACTGCGAGAATCTCGAGATTCTCGCAGTTTCTAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176979.4-220s1c1
Sequence:CCGGGCTTTATATCTGTGACCGTTTCTCGAGAAACGGTCACAGATATAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_176979.4-1722s1c1
Sequence:CCGGGCCAGAAGAGTTTCCTTGTTTCTCGAGAAACAAGGAAACTCTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_176979.4-219s1c1
Sequence:CCGGCGCTTTATATCTGTGACCGTTCTCGAGAACGGTCACAGATATAAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_176979
VALIDATED
TOPBP1 MISSION shRNA Lentiviral Transduction Particles
topoisomerase (DNA) II binding protein 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000302500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176979.5-220s21c1
Sequence:CCGGGCTTTATATCTGTGACCGTTTCTCGAGAAACGGTCACAGATATAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302499    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176979.5-4793s21c1
Sequence:CCGGCCTGAATTTGAATCACTGGTTCTCGAGAACCAGTGATTCAAATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176979.5-2221s21c1
Sequence:CCGGGCTCTTAGAAACTGCGAGAATCTCGAGATTCTCGCAGTTTCTAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176979.5-1722s21c1
Sequence:CCGGGCCAGAAGAGTTTCCTTGTTTCTCGAGAAACAAGGAAACTCTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124219    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_176979.4-4793s1c1
Sequence:CCGGCCTGAATTTGAATCACTGGTTCTCGAGAACCAGTGATTCAAATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_176979.4-2221s1c1
Sequence:CCGGGCTCTTAGAAACTGCGAGAATCTCGAGATTCTCGCAGTTTCTAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176979.4-220s1c1
Sequence:CCGGGCTTTATATCTGTGACCGTTTCTCGAGAAACGGTCACAGATATAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_176979.4-1722s1c1
Sequence:CCGGGCCAGAAGAGTTTCCTTGTTTCTCGAGAAACAAGGAAACTCTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_176979.4-219s1c1
Sequence:CCGGCGCTTTATATCTGTGACCGTTCTCGAGAACGGTCACAGATATAAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks