EMAIL THIS PAGE TO A FRIEND

TOPORS

topoisomerase I binding, arginine/serine-rich, E3 ubiquitin protein ligase

Synonyms: LUN P53BP3 RP31 TP53BPL
UniProtKB ID: Q9NS56, O43273, Q6P987, Q9NS55, Q9UNR9
Gene ID:
Human(10210) Summary: This gene encodes a nuclear protein which is serine and arginine rich, and contains a RING-type zinc finger domain. It is highly expressed in the testis, and functions as an ubiquitin-protein E3 ligase. Mutations in this gene are associated with retinitis pigmentosa type 31. Alternatively spliced transcript variants, encoding different isoforms, have been observed for this locus. [provided by RefSeq, Sep 2010]
Mouse(106021) topoisomerase I binding, arginine/serine-rich
Rat(362501) topoisomerase I binding, arginine/serine-rich, E3 ubiquitin protein ligase
fruit fly(37188) Topoisomerase I-interacting protein
Horse(100053650) topoisomerase I binding, arginine/serine-rich, E3 ubiquitin protein ligase
domestic cat(101096178) topoisomerase I binding, arginine/serine-rich, E3 ubiquitin protein ligase
dog(481577) topoisomerase I binding, arginine/serine-rich, E3 ubiquitin protein ligase
chicken(427342) topoisomerase I binding, arginine/serine-rich, E3 ubiquitin protein ligase
naked mole-rat(101717472) topoisomerase I binding, arginine/serine-rich, E3 ubiquitin protein ligase
domestic guinea pig(100718772) topoisomerase I binding, arginine/serine-rich, E3 ubiquitin protein ligase
cow(523321) topoisomerase I binding, arginine/serine-rich, E3 ubiquitin protein ligase
sheep(101113202) topoisomerase I binding, arginine/serine-rich, E3 ubiquitin protein ligase
108 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA065661 Anti-TOPORS antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA060640 Anti-TOPORS antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
WH0010210M1 Monoclonal Anti-TOPORS antibody produced in mouse clone 5G11, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1404797 Monoclonal Anti-TOPORS antibody produced in mouse clone 4G4, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1408732 Monoclonal Anti-TOPORS antibody produced in mouse clone 6E7, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1408733 Monoclonal Anti-TOPORS antibody produced in mouse clone 1A5, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1408734 Monoclonal Anti-TOPORS antibody produced in mouse clone 5G9, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1408735 Monoclonal Anti-TOPORS antibody produced in mouse clone 6D2, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1408736 Monoclonal Anti-TOPORS antibody produced in mouse clone 6C8, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1408737 Monoclonal Anti-TOPORS antibody produced in mouse clone 6F11, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1408738 Monoclonal Anti-TOPORS antibody produced in mouse clone 6B7, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1408739 Monoclonal Anti-TOPORS antibody produced in mouse clone 5G9, ascites fluid, solution human
ELISA, western blot pricing
SAB1408740 Monoclonal Anti-TOPORS antibody produced in mouse clone 6D2, ascites fluid, solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005802 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005802 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005802 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_134097 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134097 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134097 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU155261 MISSION® esiRNA esiRNA human TOPORS (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005802 Rosetta Predictions human pricing
NM_001108658 Rosetta Predictions rat pricing
NM_134097 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005802 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00066147 predicted 1113
2 SASI_Hs01_00066149 predicted 884
3 SASI_Hs01_00066150 predicted 402
4 SASI_Hs02_00340309 predicted 1388
5 SASI_Hs01_00066151 predicted 1741
6 SASI_Hs01_00066152 predicted 1643
7 SASI_Hs01_00066153 predicted 1345
8 SASI_Hs01_00066154 predicted 688
9 SASI_Hs02_00340310 predicted 637
10 SASI_Hs02_00340311 predicted 795
11 SASI_Hs01_00066148 predicted 572
12 SASI_Hs01_00066155 predicted 1919
13 SASI_Hs01_00066156 predicted 1549
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108658 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00240799 predicted 2340
2 SASI_Rn02_00240800 predicted 2284
3 SASI_Rn02_00240801 predicted 1586
4 SASI_Rn02_00240802 predicted 2312
5 SASI_Rn02_00240803 predicted 903
6 SASI_Rn02_00240804 predicted 1858
7 SASI_Rn02_00240805 predicted 2356
8 SASI_Rn02_00240806 predicted 1622
9 SASI_Rn02_00240807 predicted 700
10 SASI_Rn02_00240808 predicted 419
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134097 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00120887 predicted 3165
2 SASI_Mm01_00120888 predicted 1551
3 SASI_Mm01_00120889 predicted 888
4 SASI_Mm01_00120890 predicted 798
5 SASI_Mm02_00339327 predicted 404
6 SASI_Mm01_00120891 predicted 1575
7 SASI_Mm01_00120893 predicted 2107
8 SASI_Mm01_00120894 predicted 421
9 SASI_Mm01_00120895 predicted 1134
10 SASI_Mm01_00120896 predicted 1369
11 SASI_Mm01_00120892 predicted 2347
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005802
VALIDATED
TOPORS MISSION shRNA Bacterial Glycerol Stock
topoisomerase I binding, arginine/serine-rich, E3 ubiquitin protein ligase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000007515    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005802.2-3706s1c1
Sequence:CCGGCCCTTTGGACAGTCTTTATTTCTCGAGAAATAAAGACTGTCCAAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005802.2-582s1c1
Sequence:CCGGCCACTATGTAAACAGCCCTTTCTCGAGAAAGGGCTGTTTACATAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005802.2-2218s1c1
Sequence:CCGGGCAGAAATAGAGATCGTTATTCTCGAGAATAACGATCTCTATTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005802.2-462s1c1
Sequence:CCGGCCTGATTCTAAGTGTCCTATACTCGAGTATAGGACACTTAGAATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005802.2-1747s1c1
Sequence:CCGGGCGATGTTAGTAGATGCTCATCTCGAGATGAGCATCTACTAACATCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005802.2-651s21c1
Sequence:CCGGGTCCTAAGGCCTTCGTATAATCTCGAGATTATACGAAGGCCTTAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005802.2-991s21c1
Sequence:CCGGGTGGCCGCTACAGGGATATTTCTCGAGAAATATCCCTGTAGCGGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005802.2-1366s21c1
Sequence:CCGGAGACCCAAGAGCTGGATATTACTCGAGTAATATCCAGCTCTTGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005802.2-2218s21c1
Sequence:CCGGGCAGAAATAGAGATCGTTATTCTCGAGAATAACGATCTCTATTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272772    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005802.2-3608s21c1
Sequence:CCGGCCATACGGTATTGACATATTTCTCGAGAAATATGTCAATACCGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005802
VALIDATED
TOPORS MISSION shRNA shRNA Plasmid DNA
topoisomerase I binding, arginine/serine-rich, E3 ubiquitin protein ligase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000007515    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005802.2-3706s1c1
Sequence:CCGGCCCTTTGGACAGTCTTTATTTCTCGAGAAATAAAGACTGTCCAAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005802.2-582s1c1
Sequence:CCGGCCACTATGTAAACAGCCCTTTCTCGAGAAAGGGCTGTTTACATAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005802.2-2218s1c1
Sequence:CCGGGCAGAAATAGAGATCGTTATTCTCGAGAATAACGATCTCTATTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005802.2-462s1c1
Sequence:CCGGCCTGATTCTAAGTGTCCTATACTCGAGTATAGGACACTTAGAATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005802.2-1747s1c1
Sequence:CCGGGCGATGTTAGTAGATGCTCATCTCGAGATGAGCATCTACTAACATCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005802.2-651s21c1
Sequence:CCGGGTCCTAAGGCCTTCGTATAATCTCGAGATTATACGAAGGCCTTAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005802.2-991s21c1
Sequence:CCGGGTGGCCGCTACAGGGATATTTCTCGAGAAATATCCCTGTAGCGGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005802.2-1366s21c1
Sequence:CCGGAGACCCAAGAGCTGGATATTACTCGAGTAATATCCAGCTCTTGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005802.2-2218s21c1
Sequence:CCGGGCAGAAATAGAGATCGTTATTCTCGAGAATAACGATCTCTATTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272772    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005802.2-3608s21c1
Sequence:CCGGCCATACGGTATTGACATATTTCTCGAGAAATATGTCAATACCGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005802
VALIDATED
TOPORS MISSION shRNA Lentiviral Transduction Particles
topoisomerase I binding, arginine/serine-rich, E3 ubiquitin protein ligase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000007515    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005802.2-3706s1c1
Sequence:CCGGCCCTTTGGACAGTCTTTATTTCTCGAGAAATAAAGACTGTCCAAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005802.2-582s1c1
Sequence:CCGGCCACTATGTAAACAGCCCTTTCTCGAGAAAGGGCTGTTTACATAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005802.2-2218s1c1
Sequence:CCGGGCAGAAATAGAGATCGTTATTCTCGAGAATAACGATCTCTATTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005802.2-462s1c1
Sequence:CCGGCCTGATTCTAAGTGTCCTATACTCGAGTATAGGACACTTAGAATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005802.2-1747s1c1
Sequence:CCGGGCGATGTTAGTAGATGCTCATCTCGAGATGAGCATCTACTAACATCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005802.2-651s21c1
Sequence:CCGGGTCCTAAGGCCTTCGTATAATCTCGAGATTATACGAAGGCCTTAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005802.2-991s21c1
Sequence:CCGGGTGGCCGCTACAGGGATATTTCTCGAGAAATATCCCTGTAGCGGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005802.2-1366s21c1
Sequence:CCGGAGACCCAAGAGCTGGATATTACTCGAGTAATATCCAGCTCTTGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005802.2-2218s21c1
Sequence:CCGGGCAGAAATAGAGATCGTTATTCTCGAGAATAACGATCTCTATTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272772    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005802.2-3608s21c1
Sequence:CCGGCCATACGGTATTGACATATTTCTCGAGAAATATGTCAATACCGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134097
VALIDATED
TOPORS MISSION shRNA Bacterial Glycerol Stock
topoisomerase I binding, arginine/serine-rich, E3 ubiquitin protein ligase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000099110    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134097.2-3664s1c1
Sequence:CCGGCCATTTCTTAGACTGAAGTAACTCGAGTTACTTCAGTCTAAGAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134097.2-2905s1c1
Sequence:CCGGGCGGGTATTGAATGTAGCAATCTCGAGATTGCTACATTCAATACCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134097.2-1628s1c1
Sequence:CCGGCGGAACTTGTTGAACTGTCTTCTCGAGAAGACAGTTCAACAAGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134097.2-1027s1c1
Sequence:CCGGGCTTGCCTTCACAGATTAGTTCTCGAGAACTAATCTGTGAAGGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134097.2-1003s1c1
Sequence:CCGGGCTGAGTTCTTCCGTAGAAATCTCGAGATTTCTACGGAAGAACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134097
VALIDATED
TOPORS MISSION shRNA shRNA Plasmid DNA
topoisomerase I binding, arginine/serine-rich, E3 ubiquitin protein ligase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000099110    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134097.2-3664s1c1
Sequence:CCGGCCATTTCTTAGACTGAAGTAACTCGAGTTACTTCAGTCTAAGAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134097.2-2905s1c1
Sequence:CCGGGCGGGTATTGAATGTAGCAATCTCGAGATTGCTACATTCAATACCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134097.2-1628s1c1
Sequence:CCGGCGGAACTTGTTGAACTGTCTTCTCGAGAAGACAGTTCAACAAGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134097.2-1027s1c1
Sequence:CCGGGCTTGCCTTCACAGATTAGTTCTCGAGAACTAATCTGTGAAGGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134097.2-1003s1c1
Sequence:CCGGGCTGAGTTCTTCCGTAGAAATCTCGAGATTTCTACGGAAGAACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134097
VALIDATED
TOPORS MISSION shRNA Lentiviral Transduction Particles
topoisomerase I binding, arginine/serine-rich, E3 ubiquitin protein ligase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000099110    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134097.2-3664s1c1
Sequence:CCGGCCATTTCTTAGACTGAAGTAACTCGAGTTACTTCAGTCTAAGAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134097.2-2905s1c1
Sequence:CCGGGCGGGTATTGAATGTAGCAATCTCGAGATTGCTACATTCAATACCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134097.2-1628s1c1
Sequence:CCGGCGGAACTTGTTGAACTGTCTTCTCGAGAAGACAGTTCAACAAGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134097.2-1027s1c1
Sequence:CCGGGCTTGCCTTCACAGATTAGTTCTCGAGAACTAATCTGTGAAGGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134097.2-1003s1c1
Sequence:CCGGGCTGAGTTCTTCCGTAGAAATCTCGAGATTTCTACGGAAGAACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks