EMAIL THIS PAGE TO A FRIEND

TOR1A

torsin family 1, member A (torsin A)

Synonyms: DQ2 DYT1
UniProtKB ID: O14656, B2RB58, Q53Y64, Q96CA0
Gene ID:
Human(1861) Summary: The protein encoded by this gene is a member of the AAA family of adenosine triphosphatases (ATPases), is related to the Clp protease/heat shock family and is expressed prominently in the substantia nigra pars compacta. Mutations in this gene result in the autosomal dominant disorder, torsion dystonia 1. [provided by RefSeq, Jul 2008]
Mouse(30931) torsin family 1, member A (torsin A)
Rat(266606) torsin family 1, member A
chicken(417190) torsin family 1, member A (torsin A)
domestic cat(101096018) torsin family 1, member A (torsin A)
dog(491296) torsin family 1, member A (torsin A)
cow(533699) torsin family 1, member A (torsin A)
sheep(101103390) torsin family 1, member A (torsin A)
domestic guinea pig(100731293) torsin family 1, member A (torsin A)
naked mole-rat(101702886) torsin family 1, member A (torsin A)
64 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000113 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000113 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000113 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_144884 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144884 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144884 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000113 Rosetta Predictions human pricing
NM_153303 Rosetta Predictions rat pricing
NM_144884 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000113 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00058159 predicted 479
2 SASI_Hs01_00058160 predicted 1047
3 SASI_Hs02_00301896 predicted 409
4 SASI_Hs01_00058162 predicted 1077
5 SASI_Hs01_00058163 predicted 494
6 SASI_Hs02_00301897 predicted 322
7 SASI_Hs01_00058165 predicted 304
8 SASI_Hs02_00301898 predicted 763
9 SASI_Hs01_00058166 predicted 772
10 SASI_Hs01_00058167 predicted 348
11 SASI_Hs01_00058161 predicted 512
12 SASI_Hs01_00058164 predicted 768
13 SASI_Hs01_00058168 predicted 1066
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153303 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00079004 predicted 410
2 SASI_Rn01_00079005 predicted 581
3 SASI_Rn01_00079006 predicted 723
4 SASI_Rn01_00079007 predicted 459
5 SASI_Rn01_00079008 predicted 424
6 SASI_Rn01_00079009 predicted 475
7 SASI_Rn01_00079010 predicted 369
8 SASI_Rn01_00079011 predicted 1015
9 SASI_Rn01_00079013 predicted 595
10 SASI_Rn02_00268947 predicted 370
11 SASI_Rn01_00079012 predicted 814
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144884 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00157320 predicted 417
2 SASI_Mm01_00157321 predicted 380
3 SASI_Mm01_00157322 predicted 606
4 SASI_Mm01_00157323 predicted 590
5 SASI_Mm01_00157324 predicted 378
6 SASI_Mm01_00157326 predicted 250
7 SASI_Mm01_00157328 predicted 813
8 SASI_Mm01_00157329 predicted 466
9 SASI_Mm02_00340334 predicted 732
10 SASI_Mm02_00340335 predicted 815
11 SASI_Mm01_00157325 predicted 432
12 SASI_Mm01_00157327 predicted 1098
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000113
VALIDATED
TOR1A MISSION shRNA Bacterial Glycerol Stock
torsin family 1, member A (torsin A)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000344797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000113.2-625s21c1
Sequence:CCGGTCAAGCCTTTCCTCGACTATTCTCGAGAATAGTCGAGGAAAGGCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000113.2-411s21c1
Sequence:CCGGAGCAAGATCATCGCAGAGAATCTCGAGATTCTCTGCGATGATCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000113.2-1043s21c1
Sequence:CCGGGTTCACCAAGTTAGATTATTACTCGAGTAATAATCTAACTTGGTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000113.2-854s21c1
Sequence:CCGGCCGGAACCTCATTGATTATTTCTCGAGAAATAATCAATGAGGTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082883    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000113.1-1911s1c1
Sequence:CCGGGCCATATTAAATCTTCCTCATCTCGAGATGAGGAAGATTTAATATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000113.1-819s1c1
Sequence:CCGGCCGGAACCTCATTGATTATTTCTCGAGAAATAATCAATGAGGTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000113.1-376s1c1
Sequence:CCGGAGCAAGATCATCGCAGAGAATCTCGAGATTCTCTGCGATGATCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000113.1-442s1c1
Sequence:CCGGGCCACATTGCACTTTCCACATCTCGAGATGTGGAAAGTGCAATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000113.1-529s1c1
Sequence:CCGGGCGAGGTCCATCTTCATATTTCTCGAGAAATATGAAGATGGACCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000113
VALIDATED
TOR1A MISSION shRNA shRNA Plasmid DNA
torsin family 1, member A (torsin A)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000344797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000113.2-625s21c1
Sequence:CCGGTCAAGCCTTTCCTCGACTATTCTCGAGAATAGTCGAGGAAAGGCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000113.2-411s21c1
Sequence:CCGGAGCAAGATCATCGCAGAGAATCTCGAGATTCTCTGCGATGATCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000113.2-1043s21c1
Sequence:CCGGGTTCACCAAGTTAGATTATTACTCGAGTAATAATCTAACTTGGTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000113.2-854s21c1
Sequence:CCGGCCGGAACCTCATTGATTATTTCTCGAGAAATAATCAATGAGGTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082883    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000113.1-1911s1c1
Sequence:CCGGGCCATATTAAATCTTCCTCATCTCGAGATGAGGAAGATTTAATATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000113.1-819s1c1
Sequence:CCGGCCGGAACCTCATTGATTATTTCTCGAGAAATAATCAATGAGGTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000113.1-376s1c1
Sequence:CCGGAGCAAGATCATCGCAGAGAATCTCGAGATTCTCTGCGATGATCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000113.1-442s1c1
Sequence:CCGGGCCACATTGCACTTTCCACATCTCGAGATGTGGAAAGTGCAATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000113.1-529s1c1
Sequence:CCGGGCGAGGTCCATCTTCATATTTCTCGAGAAATATGAAGATGGACCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000113
VALIDATED
TOR1A MISSION shRNA Lentiviral Transduction Particles
torsin family 1, member A (torsin A)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000344797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000113.2-625s21c1
Sequence:CCGGTCAAGCCTTTCCTCGACTATTCTCGAGAATAGTCGAGGAAAGGCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000113.2-411s21c1
Sequence:CCGGAGCAAGATCATCGCAGAGAATCTCGAGATTCTCTGCGATGATCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000113.2-1043s21c1
Sequence:CCGGGTTCACCAAGTTAGATTATTACTCGAGTAATAATCTAACTTGGTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000113.2-854s21c1
Sequence:CCGGCCGGAACCTCATTGATTATTTCTCGAGAAATAATCAATGAGGTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082883    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000113.1-1911s1c1
Sequence:CCGGGCCATATTAAATCTTCCTCATCTCGAGATGAGGAAGATTTAATATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000113.1-819s1c1
Sequence:CCGGCCGGAACCTCATTGATTATTTCTCGAGAAATAATCAATGAGGTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000113.1-376s1c1
Sequence:CCGGAGCAAGATCATCGCAGAGAATCTCGAGATTCTCTGCGATGATCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000113.1-442s1c1
Sequence:CCGGGCCACATTGCACTTTCCACATCTCGAGATGTGGAAAGTGCAATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000113.1-529s1c1
Sequence:CCGGGCGAGGTCCATCTTCATATTTCTCGAGAAATATGAAGATGGACCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144884
VALIDATED
TOR1A MISSION shRNA Bacterial Glycerol Stock
torsin family 1, member A (torsin A)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000280525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144884.1-227s21c1
Sequence:CCGGGCTGCAGAAAGATCTGGATAACTCGAGTTATCCAGATCTTTCTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144884.1-600s21c1
Sequence:CCGGCCTTTCCTAGACTATTACGATCTCGAGATCGTAATAGTCTAGGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144884.1-824s21c1
Sequence:CCGGCCGGAACCTCATAGATTATTTCTCGAGAAATAATCTATGAGGTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280516    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144884.1-1227s21c1
Sequence:CCGGCCAGCATTCTGGACTTGTGATCTCGAGATCACAAGTCCAGAATGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008483    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144884.1-1227s1c1
Sequence:CCGGCCAGCATTCTGGACTTGTGATCTCGAGATCACAAGTCCAGAATGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144884.1-227s1c1
Sequence:CCGGGCTGCAGAAAGATCTGGATAACTCGAGTTATCCAGATCTTTCTGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144884.1-468s1c1
Sequence:CCGGGCCTCTAACATCACACAGTATCTCGAGATACTGTGTGATGTTAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144884.1-824s1c1
Sequence:CCGGCCGGAACCTCATAGATTATTTCTCGAGAAATAATCTATGAGGTTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144884.1-600s1c1
Sequence:CCGGCCTTTCCTAGACTATTACGATCTCGAGATCGTAATAGTCTAGGAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144884
VALIDATED
TOR1A MISSION shRNA shRNA Plasmid DNA
torsin family 1, member A (torsin A)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000280525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144884.1-227s21c1
Sequence:CCGGGCTGCAGAAAGATCTGGATAACTCGAGTTATCCAGATCTTTCTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144884.1-600s21c1
Sequence:CCGGCCTTTCCTAGACTATTACGATCTCGAGATCGTAATAGTCTAGGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144884.1-824s21c1
Sequence:CCGGCCGGAACCTCATAGATTATTTCTCGAGAAATAATCTATGAGGTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280516    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144884.1-1227s21c1
Sequence:CCGGCCAGCATTCTGGACTTGTGATCTCGAGATCACAAGTCCAGAATGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008483    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144884.1-1227s1c1
Sequence:CCGGCCAGCATTCTGGACTTGTGATCTCGAGATCACAAGTCCAGAATGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144884.1-227s1c1
Sequence:CCGGGCTGCAGAAAGATCTGGATAACTCGAGTTATCCAGATCTTTCTGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144884.1-468s1c1
Sequence:CCGGGCCTCTAACATCACACAGTATCTCGAGATACTGTGTGATGTTAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144884.1-824s1c1
Sequence:CCGGCCGGAACCTCATAGATTATTTCTCGAGAAATAATCTATGAGGTTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144884.1-600s1c1
Sequence:CCGGCCTTTCCTAGACTATTACGATCTCGAGATCGTAATAGTCTAGGAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144884
VALIDATED
TOR1A MISSION shRNA Lentiviral Transduction Particles
torsin family 1, member A (torsin A)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000280525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144884.1-227s21c1
Sequence:CCGGGCTGCAGAAAGATCTGGATAACTCGAGTTATCCAGATCTTTCTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144884.1-600s21c1
Sequence:CCGGCCTTTCCTAGACTATTACGATCTCGAGATCGTAATAGTCTAGGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144884.1-824s21c1
Sequence:CCGGCCGGAACCTCATAGATTATTTCTCGAGAAATAATCTATGAGGTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280516    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144884.1-1227s21c1
Sequence:CCGGCCAGCATTCTGGACTTGTGATCTCGAGATCACAAGTCCAGAATGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008483    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144884.1-1227s1c1
Sequence:CCGGCCAGCATTCTGGACTTGTGATCTCGAGATCACAAGTCCAGAATGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144884.1-227s1c1
Sequence:CCGGGCTGCAGAAAGATCTGGATAACTCGAGTTATCCAGATCTTTCTGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144884.1-468s1c1
Sequence:CCGGGCCTCTAACATCACACAGTATCTCGAGATACTGTGTGATGTTAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144884.1-824s1c1
Sequence:CCGGCCGGAACCTCATAGATTATTTCTCGAGAAATAATCTATGAGGTTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144884.1-600s1c1
Sequence:CCGGCCTTTCCTAGACTATTACGATCTCGAGATCGTAATAGTCTAGGAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks