EMAIL THIS PAGE TO A FRIEND

TOR1AIP1

torsin A interacting protein 1

Synonyms: LAP1 LAP1B
Gene ID:
Human(26092) Summary: This gene encodes a type 2 integral membrane protein that binds A- and B-type laminins. The encoded protein localizes to the inner nuclear membrane and may be involved in maintaining the attachment of the nuclear membrane to the nuclear lamina during cell division. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jun 2012]
Mouse(208263) torsin A interacting protein 1
Rat(246314) torsin A interacting protein 1
naked mole-rat(101723981) torsin A interacting protein 1
domestic guinea pig(100715063) torsin A interacting protein 1
cow(782528) torsin A interacting protein 1
sheep(101119409) torsin A interacting protein 1
chicken(424418) torsin A interacting protein 1
dog(610317) torsin A interacting protein 1
domestic cat(101095790) torsin A interacting protein 1
98 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144791 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144791 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144791 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015602 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015602 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015602 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015602 Rosetta Predictions human pricing
NM_145092 Rosetta Predictions rat pricing
NM_144791 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015602 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00125384 predicted 1344
2 SASI_Hs01_00125385 predicted 1291
3 SASI_Hs01_00125386 predicted 1728
4 SASI_Hs01_00125387 predicted 1320
5 SASI_Hs01_00125388 predicted 571
6 SASI_Hs01_00125389 predicted 1539
7 SASI_Hs01_00125391 predicted 1951
8 SASI_Hs01_00125392 predicted 1103
9 SASI_Hs01_00125393 predicted 909
10 SASI_Hs02_00348187 predicted 962
11 SASI_Hs01_00125390 predicted 1049
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145092 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00121148 predicted 1088
2 SASI_Rn01_00121149 predicted 744
3 SASI_Rn01_00121150 predicted 1229
4 SASI_Rn01_00121151 predicted 1245
5 SASI_Rn02_00268688 predicted 985
6 SASI_Rn01_00121152 predicted 1047
7 SASI_Rn01_00121153 predicted 756
8 SASI_Rn01_00121154 predicted 734
9 SASI_Rn01_00121156 predicted 1072
10 SASI_Rn01_00121157 predicted 911
11 SASI_Rn01_00121155 predicted 626
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144791 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00187522 predicted 774
2 SASI_Mm01_00187523 predicted 854
3 SASI_Mm01_00187524 predicted 621
4 SASI_Mm01_00187525 predicted 662
5 SASI_Mm01_00187526 predicted 811
6 SASI_Mm01_00187527 predicted 1282
7 SASI_Mm01_00187528 predicted 1370
8 SASI_Mm01_00187529 predicted 855
9 SASI_Mm02_00340129 predicted 852
10 SASI_Mm02_00340130 predicted 778
11 SASI_Mm01_00187530 predicted 676
12 SASI_Mm01_00187531 predicted 418
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144791
TOR1AIP1 MISSION shRNA Bacterial Glycerol Stock
torsin A interacting protein 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000181753    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144791.1-1432s1c1
Sequence:CCGGGCCAGTTTAGGCCTAAAGGAACTCGAGTTCCTTTAGGCCTAAACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178198    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144791.1-663s1c1
Sequence:CCGGCCCAAGACTTGACTCAACATACTCGAGTATGTTGAGTCAAGTCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197597    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144791.1-1137s1c1
Sequence:CCGGCAAGTGTCTGAGTGAACAAATCTCGAGATTTGTTCACTCAGACACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216922    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144791.1-725s1c1
Sequence:CCGGCCATTGTCCAACAGGTCAATTCTCGAGAATTGACCTGTTGGACAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217306    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144791.1-1260s1c1
Sequence:CCGGGGAGCTGACTGATGGATTTAACTCGAGTTAAATCCATCAGTCAGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217597    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144791.1-615s1c1
Sequence:CCGGGATGAATGAAGACCCTATAAGCTCGAGCTTATAGGGTCTTCATTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144791.1-725s21c1
Sequence:CCGGCCATTGTCCAACAGGTCAATTCTCGAGAATTGACCTGTTGGACAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144791.1-1333s21c1
Sequence:CCGGTCAACCTTGATCTTCTATAAACTCGAGTTTATAGAAGATCAAGGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144791.1-614s21c1
Sequence:CCGGTGATGAATGAAGACCCTATAACTCGAGTTATAGGGTCTTCATTCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144791.1-664s21c1
Sequence:CCGGCCAAGACTTGACTCAACATACCTCGAGGTATGTTGAGTCAAGTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144791
TOR1AIP1 MISSION shRNA shRNA Plasmid DNA
torsin A interacting protein 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000181753    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144791.1-1432s1c1
Sequence:CCGGGCCAGTTTAGGCCTAAAGGAACTCGAGTTCCTTTAGGCCTAAACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178198    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144791.1-663s1c1
Sequence:CCGGCCCAAGACTTGACTCAACATACTCGAGTATGTTGAGTCAAGTCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197597    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144791.1-1137s1c1
Sequence:CCGGCAAGTGTCTGAGTGAACAAATCTCGAGATTTGTTCACTCAGACACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216922    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144791.1-725s1c1
Sequence:CCGGCCATTGTCCAACAGGTCAATTCTCGAGAATTGACCTGTTGGACAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217306    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144791.1-1260s1c1
Sequence:CCGGGGAGCTGACTGATGGATTTAACTCGAGTTAAATCCATCAGTCAGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217597    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144791.1-615s1c1
Sequence:CCGGGATGAATGAAGACCCTATAAGCTCGAGCTTATAGGGTCTTCATTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144791.1-725s21c1
Sequence:CCGGCCATTGTCCAACAGGTCAATTCTCGAGAATTGACCTGTTGGACAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144791.1-1333s21c1
Sequence:CCGGTCAACCTTGATCTTCTATAAACTCGAGTTTATAGAAGATCAAGGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144791.1-614s21c1
Sequence:CCGGTGATGAATGAAGACCCTATAACTCGAGTTATAGGGTCTTCATTCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144791.1-664s21c1
Sequence:CCGGCCAAGACTTGACTCAACATACCTCGAGGTATGTTGAGTCAAGTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144791
TOR1AIP1 MISSION shRNA Lentiviral Transduction Particles
torsin A interacting protein 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000181753    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144791.1-1432s1c1
Sequence:CCGGGCCAGTTTAGGCCTAAAGGAACTCGAGTTCCTTTAGGCCTAAACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178198    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144791.1-663s1c1
Sequence:CCGGCCCAAGACTTGACTCAACATACTCGAGTATGTTGAGTCAAGTCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197597    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144791.1-1137s1c1
Sequence:CCGGCAAGTGTCTGAGTGAACAAATCTCGAGATTTGTTCACTCAGACACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216922    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144791.1-725s1c1
Sequence:CCGGCCATTGTCCAACAGGTCAATTCTCGAGAATTGACCTGTTGGACAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217306    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144791.1-1260s1c1
Sequence:CCGGGGAGCTGACTGATGGATTTAACTCGAGTTAAATCCATCAGTCAGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217597    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144791.1-615s1c1
Sequence:CCGGGATGAATGAAGACCCTATAAGCTCGAGCTTATAGGGTCTTCATTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144791.1-725s21c1
Sequence:CCGGCCATTGTCCAACAGGTCAATTCTCGAGAATTGACCTGTTGGACAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144791.1-1333s21c1
Sequence:CCGGTCAACCTTGATCTTCTATAAACTCGAGTTTATAGAAGATCAAGGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144791.1-614s21c1
Sequence:CCGGTGATGAATGAAGACCCTATAACTCGAGTTATAGGGTCTTCATTCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144791.1-664s21c1
Sequence:CCGGCCAAGACTTGACTCAACATACCTCGAGGTATGTTGAGTCAAGTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015602
VALIDATED
TOR1AIP1 MISSION shRNA Bacterial Glycerol Stock
torsin A interacting protein 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172297    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015602.2-1673s1c1
Sequence:CCGGCGCAGGCTCTACTTTGATCTTCTCGAGAAGATCAAAGTAGAGCCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015602.2-836s1c1
Sequence:CCGGCAGTGTCCAACAGAAGGTCAACTCGAGTTGACCTTCTGTTGGACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168040    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015602.2-3112s1c1
Sequence:CCGGCCTGGGCTATTGAAGAAGATTCTCGAGAATCTTCTTCAATAGCCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167048    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015602.2-2690s1c1
Sequence:CCGGCCAAGGATTCTTCATGTATATCTCGAGATATACATGAAGAATCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167883    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015602.2-2361s1c1
Sequence:CCGGCCCTAAATGTAACCAGGGATTCTCGAGAATCCCTGGTTACATTTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015602.2-1325s1c1
Sequence:CCGGGAACCAGATGAATCAACTTAACTCGAGTTAAGTTGATTCATCTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015602.2-1544s21c1
Sequence:CCGGCCGGATTGATGGGACAGATAACTCGAGTTATCTGTCCCATCAATCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015602.2-1853s21c1
Sequence:CCGGACCCAACTCCTACAATCATATCTCGAGATATGATTGTAGGAGTTGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015602.2-1283s21c1
Sequence:CCGGTAGTACTCCTGAGGTAGAAACCTCGAGGTTTCTACCTCAGGAGTACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015602
VALIDATED
TOR1AIP1 MISSION shRNA shRNA Plasmid DNA
torsin A interacting protein 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000172297    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015602.2-1673s1c1
Sequence:CCGGCGCAGGCTCTACTTTGATCTTCTCGAGAAGATCAAAGTAGAGCCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015602.2-836s1c1
Sequence:CCGGCAGTGTCCAACAGAAGGTCAACTCGAGTTGACCTTCTGTTGGACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168040    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015602.2-3112s1c1
Sequence:CCGGCCTGGGCTATTGAAGAAGATTCTCGAGAATCTTCTTCAATAGCCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167048    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015602.2-2690s1c1
Sequence:CCGGCCAAGGATTCTTCATGTATATCTCGAGATATACATGAAGAATCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167883    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015602.2-2361s1c1
Sequence:CCGGCCCTAAATGTAACCAGGGATTCTCGAGAATCCCTGGTTACATTTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015602.2-1325s1c1
Sequence:CCGGGAACCAGATGAATCAACTTAACTCGAGTTAAGTTGATTCATCTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015602.2-1544s21c1
Sequence:CCGGCCGGATTGATGGGACAGATAACTCGAGTTATCTGTCCCATCAATCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015602.2-1853s21c1
Sequence:CCGGACCCAACTCCTACAATCATATCTCGAGATATGATTGTAGGAGTTGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015602.2-1283s21c1
Sequence:CCGGTAGTACTCCTGAGGTAGAAACCTCGAGGTTTCTACCTCAGGAGTACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015602
VALIDATED
TOR1AIP1 MISSION shRNA Lentiviral Transduction Particles
torsin A interacting protein 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000172297    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015602.2-1673s1c1
Sequence:CCGGCGCAGGCTCTACTTTGATCTTCTCGAGAAGATCAAAGTAGAGCCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015602.2-836s1c1
Sequence:CCGGCAGTGTCCAACAGAAGGTCAACTCGAGTTGACCTTCTGTTGGACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168040    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015602.2-3112s1c1
Sequence:CCGGCCTGGGCTATTGAAGAAGATTCTCGAGAATCTTCTTCAATAGCCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167048    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015602.2-2690s1c1
Sequence:CCGGCCAAGGATTCTTCATGTATATCTCGAGATATACATGAAGAATCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167883    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015602.2-2361s1c1
Sequence:CCGGCCCTAAATGTAACCAGGGATTCTCGAGAATCCCTGGTTACATTTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015602.2-1325s1c1
Sequence:CCGGGAACCAGATGAATCAACTTAACTCGAGTTAAGTTGATTCATCTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015602.2-1544s21c1
Sequence:CCGGCCGGATTGATGGGACAGATAACTCGAGTTATCTGTCCCATCAATCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015602.2-1853s21c1
Sequence:CCGGACCCAACTCCTACAATCATATCTCGAGATATGATTGTAGGAGTTGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015602.2-1283s21c1
Sequence:CCGGTAGTACTCCTGAGGTAGAAACCTCGAGGTTTCTACCTCAGGAGTACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks