EMAIL THIS PAGE TO A FRIEND

TOR1AIP2

torsin A interacting protein 2

Synonyms: IFRG15 LULL1 NET9 RP11-12M5.5
UniProtKB ID: Q8NFQ8
Gene ID:
Mouse(240832) torsin A interacting protein 2
Rat(304881) torsin A interacting protein 2
chicken(424419) torsin A interacting protein 2
dog(610310) torsin A interacting protein 2
domestic cat(101096439) torsin A interacting protein 2
Horse(100050862) torsin A interacting protein 2
cow(782450) torsin A interacting protein 2
sheep(101122123) torsin A interacting protein 2
domestic guinea pig(100715339) torsin A interacting protein 2
naked mole-rat(101721860) torsin A interacting protein 2
62 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172843 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172843 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172843 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_145034 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145034 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145034 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145034 Rosetta Predictions human pricing
NM_199100 Rosetta Predictions rat pricing
NM_172843 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145034 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00083910 predicted 1030
2 SASI_Hs01_00083911 predicted 1165
3 SASI_Hs01_00083912 predicted 1811
4 SASI_Hs01_00083914 predicted 1647
5 SASI_Hs01_00083915 predicted 1038
6 SASI_Hs01_00083916 predicted 1156
7 SASI_Hs01_00083917 predicted 529
8 SASI_Hs01_00083918 predicted 1730
9 SASI_Hs02_00364903 predicted 1439
10 SASI_Hs02_00364904 predicted 571
11 SASI_Hs01_00083913 predicted 1524
12 SASI_Hs01_00083919 predicted 1604
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199100 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00090077 predicted 1799
2 SASI_Rn01_00090079 predicted 1269
3 SASI_Rn01_00090080 predicted 428
4 SASI_Rn02_00270118 predicted 243
5 SASI_Rn02_00270119 predicted 937
6 SASI_Rn01_00090082 predicted 942
7 SASI_Rn01_00090083 predicted 1128
8 SASI_Rn01_00090084 predicted 1170
9 SASI_Rn01_00090085 predicted 1512
10 SASI_Rn01_00090086 predicted 1756
11 SASI_Rn01_00090078 predicted 1110
12 SASI_Rn01_00090081 predicted 1980
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172843 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00344777 predicted 411
2 SASI_Mm02_00344778 predicted 861
3 SASI_Mm02_00344779 predicted 523
4 SASI_Mm02_00344780 predicted 1394
5 SASI_Mm02_00344781 predicted 894
6 SASI_Mm02_00344782 predicted 1499
7 SASI_Mm02_00344783 predicted 237
8 SASI_Mm02_00344784 predicted 1075
9 SASI_Mm02_00344785 predicted 1009
10 SASI_Mm02_00344786 predicted 1517
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172843
VALIDATED
TOR1AIP2 MISSION shRNA Bacterial Glycerol Stock
torsin A interacting protein 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000285958    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172843.2-3566s21c1
Sequence:CCGGGCTGACTTTGAACTTAGAGTACTCGAGTACTCTAAGTTCAAAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277370    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172843.2-2597s21c1
Sequence:CCGGGCTGAGTTTCACAGAGAAGTTCTCGAGAACTTCTCTGTGAAACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172843.2-271s21c1
Sequence:CCGGCACCAGAGTCACACCGAATAACTCGAGTTATTCGGTGTGACTCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172843.2-1297s21c1
Sequence:CCGGGCTTAGCGATGGGTTTGAGAACTCGAGTTCTCAAACCCATCGCTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172843.2-894s21c1
Sequence:CCGGGGACCTATGGTTCCGTGTTTCCTCGAGGAAACACGGAACCATAGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172843.2-1297s1c1
Sequence:CCGGGCTTAGCGATGGGTTTGAGAACTCGAGTTCTCAAACCCATCGCTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172843.2-945s1c1
Sequence:CCGGGCTCCGTCAACAGCTACTATTCTCGAGAATAGTAGCTGTTGACGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180743    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172843.2-2597s1c1
Sequence:CCGGGCTGAGTTTCACAGAGAAGTTCTCGAGAACTTCTCTGTGAAACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179322    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172843.2-3566s1c1
Sequence:CCGGGCTGACTTTGAACTTAGAGTACTCGAGTACTCTAAGTTCAAAGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172843
VALIDATED
TOR1AIP2 MISSION shRNA shRNA Plasmid DNA
torsin A interacting protein 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000285958    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172843.2-3566s21c1
Sequence:CCGGGCTGACTTTGAACTTAGAGTACTCGAGTACTCTAAGTTCAAAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277370    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172843.2-2597s21c1
Sequence:CCGGGCTGAGTTTCACAGAGAAGTTCTCGAGAACTTCTCTGTGAAACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172843.2-271s21c1
Sequence:CCGGCACCAGAGTCACACCGAATAACTCGAGTTATTCGGTGTGACTCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172843.2-1297s21c1
Sequence:CCGGGCTTAGCGATGGGTTTGAGAACTCGAGTTCTCAAACCCATCGCTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172843.2-894s21c1
Sequence:CCGGGGACCTATGGTTCCGTGTTTCCTCGAGGAAACACGGAACCATAGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172843.2-1297s1c1
Sequence:CCGGGCTTAGCGATGGGTTTGAGAACTCGAGTTCTCAAACCCATCGCTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172843.2-945s1c1
Sequence:CCGGGCTCCGTCAACAGCTACTATTCTCGAGAATAGTAGCTGTTGACGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180743    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172843.2-2597s1c1
Sequence:CCGGGCTGAGTTTCACAGAGAAGTTCTCGAGAACTTCTCTGTGAAACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179322    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172843.2-3566s1c1
Sequence:CCGGGCTGACTTTGAACTTAGAGTACTCGAGTACTCTAAGTTCAAAGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172843
VALIDATED
TOR1AIP2 MISSION shRNA Lentiviral Transduction Particles
torsin A interacting protein 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000285958    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172843.2-3566s21c1
Sequence:CCGGGCTGACTTTGAACTTAGAGTACTCGAGTACTCTAAGTTCAAAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277370    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172843.2-2597s21c1
Sequence:CCGGGCTGAGTTTCACAGAGAAGTTCTCGAGAACTTCTCTGTGAAACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172843.2-271s21c1
Sequence:CCGGCACCAGAGTCACACCGAATAACTCGAGTTATTCGGTGTGACTCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172843.2-1297s21c1
Sequence:CCGGGCTTAGCGATGGGTTTGAGAACTCGAGTTCTCAAACCCATCGCTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172843.2-894s21c1
Sequence:CCGGGGACCTATGGTTCCGTGTTTCCTCGAGGAAACACGGAACCATAGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172843.2-1297s1c1
Sequence:CCGGGCTTAGCGATGGGTTTGAGAACTCGAGTTCTCAAACCCATCGCTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172843.2-945s1c1
Sequence:CCGGGCTCCGTCAACAGCTACTATTCTCGAGAATAGTAGCTGTTGACGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180743    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172843.2-2597s1c1
Sequence:CCGGGCTGAGTTTCACAGAGAAGTTCTCGAGAACTTCTCTGTGAAACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179322    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172843.2-3566s1c1
Sequence:CCGGGCTGACTTTGAACTTAGAGTACTCGAGTACTCTAAGTTCAAAGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145034
TOR1AIP2 MISSION shRNA Bacterial Glycerol Stock
torsin A interacting protein 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145034.1-1507s1c1
Sequence:CCGGGCTCCACTTTGATCTTCTATACTCGAGTATAGAAGATCAAAGTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149359    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145034.1-1895s1c1
Sequence:CCGGGCTTGAGGAAATAGCCTGAAACTCGAGTTTCAGGCTATTTCCTCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149390    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145034.1-2088s1c1
Sequence:CCGGGCAACATTGCACAGGAAGATACTCGAGTATCTTCCTGTGCAATGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145034.1-1697s1c1
Sequence:CCGGCCACATGGACTCAGACAAATTCTCGAGAATTTGTCTGAGTCCATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145034.1-1269s1c1
Sequence:CCGGGCCACCATCATATTTACAGCACTCGAGTGCTGTAAATATGATGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145034
TOR1AIP2 MISSION shRNA shRNA Plasmid DNA
torsin A interacting protein 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145034.1-1507s1c1
Sequence:CCGGGCTCCACTTTGATCTTCTATACTCGAGTATAGAAGATCAAAGTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149359    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145034.1-1895s1c1
Sequence:CCGGGCTTGAGGAAATAGCCTGAAACTCGAGTTTCAGGCTATTTCCTCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149390    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145034.1-2088s1c1
Sequence:CCGGGCAACATTGCACAGGAAGATACTCGAGTATCTTCCTGTGCAATGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145034.1-1697s1c1
Sequence:CCGGCCACATGGACTCAGACAAATTCTCGAGAATTTGTCTGAGTCCATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145034.1-1269s1c1
Sequence:CCGGGCCACCATCATATTTACAGCACTCGAGTGCTGTAAATATGATGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145034
TOR1AIP2 MISSION shRNA Lentiviral Transduction Particles
torsin A interacting protein 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145034.1-1507s1c1
Sequence:CCGGGCTCCACTTTGATCTTCTATACTCGAGTATAGAAGATCAAAGTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149359    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145034.1-1895s1c1
Sequence:CCGGGCTTGAGGAAATAGCCTGAAACTCGAGTTTCAGGCTATTTCCTCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149390    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145034.1-2088s1c1
Sequence:CCGGGCAACATTGCACAGGAAGATACTCGAGTATCTTCCTGTGCAATGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145034.1-1697s1c1
Sequence:CCGGCCACATGGACTCAGACAAATTCTCGAGAATTTGTCTGAGTCCATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145034.1-1269s1c1
Sequence:CCGGGCCACCATCATATTTACAGCACTCGAGTGCTGTAAATATGATGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks