EMAIL THIS PAGE TO A FRIEND

TOR1B

torsin family 1, member B (torsin B)

Synonyms: DQ1
UniProtKB ID: O14657
Gene ID:
Mouse(30934) torsin family 1, member B
Rat(311854) torsin family 1, member B
naked mole-rat(101698615) torsin family 1, member B (torsin B)
domestic guinea pig(100732945) torsin family 1, member B (torsin B)
cow(533928) torsin family 1, member B (torsin B)
sheep(101103637) torsin family 1, member B (torsin B)
chicken(417191) torsin family 1, member B (torsin B)
dog(491297) torsin family 1, member B (torsin B)
domestic cat(101095776) torsin family 1, member B (torsin B)
56 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133673 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133673 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133673 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014506 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014506 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014506 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014506 Rosetta Predictions human pricing
NM_001039197 Rosetta Predictions rat pricing
NM_133673 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014506 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00194763 predicted 556
2 SASI_Hs01_00194764 predicted 253
3 SASI_Hs01_00194765 predicted 840
4 SASI_Hs01_00194766 predicted 448
5 SASI_Hs01_00194767 predicted 887
6 SASI_Hs01_00194768 predicted 1567
7 SASI_Hs01_00194769 predicted 780
8 SASI_Hs01_00194770 predicted 291
9 SASI_Hs01_00194771 predicted 798
10 SASI_Hs01_00194772 predicted 236
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039197 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00059314 predicted 405
2 SASI_Rn01_00059315 predicted 196
3 SASI_Rn01_00059316 predicted 1170
4 SASI_Rn01_00059317 predicted 1168
5 SASI_Rn01_00059318 predicted 272
6 SASI_Rn01_00059319 predicted 303
7 SASI_Rn01_00059320 predicted 309
8 SASI_Rn01_00059321 predicted 799
9 SASI_Rn01_00059322 predicted 272
10 SASI_Rn01_00059323 predicted 1506
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133673 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00196177 predicted 624
2 SASI_Mm01_00196178 predicted 1523
3 SASI_Mm01_00196179 predicted 418
4 SASI_Mm01_00196180 predicted 269
5 SASI_Mm01_00196181 predicted 670
6 SASI_Mm02_00338622 predicted 562
7 SASI_Mm01_00196182 predicted 257
8 SASI_Mm01_00196183 predicted 280
9 SASI_Mm01_00196184 predicted 221
10 SASI_Mm01_00196185 predicted 567
11 SASI_Mm01_00196186 predicted 506
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133673
VALIDATED
TOR1B MISSION shRNA Bacterial Glycerol Stock
torsin family 1, member B (torsin B)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106485    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133673.2-2002s1c1
Sequence:CCGGGCAGGTAGATTCTGGGAGTTTCTCGAGAAACTCCCAGAATCTACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133673.2-152s1c1
Sequence:CCGGCCTGTCCTATACCGATTTCTACTCGAGTAGAAATCGGTATAGGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133673.2-272s1c1
Sequence:CCGGCGAAGTGATTCTCAAGGCATTCTCGAGAATGCCTTGAGAATCACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133673.2-797s1c1
Sequence:CCGGCCTGTGGCACAGTGGGCTAATCTCGAGATTAGCCCACTGTGCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133673.2-431s1c1
Sequence:CCGGCCACCTGTTCGTCTCTACTTTCTCGAGAAAGTAGAGACGAACAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133673.3-596s21c1
Sequence:CCGGAGCCCTTCCTGGACTACTATGCTCGAGCATAGTAGTCCAGGAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133673.3-851s21c1
Sequence:CCGGTCCTGCCCTTGGAGTACAAACCTCGAGGTTTGTACTCCAAGGGCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133673.3-273s21c1
Sequence:CCGGCGAAGTGATTCTCAAGGCATTCTCGAGAATGCCTTGAGAATCACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133673.3-432s21c2
Sequence:CCGGCCACCTGTTCGTCTCTACTTTCTCGAGAAAGTAGAGACGAACAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351239    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133673.3-2003s21c2
Sequence:CCGGGCAGGTAGATTCTGGGAGTTTCTCGAGAAACTCCCAGAATCTACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133673
VALIDATED
TOR1B MISSION shRNA shRNA Plasmid DNA
torsin family 1, member B (torsin B)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106485    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133673.2-2002s1c1
Sequence:CCGGGCAGGTAGATTCTGGGAGTTTCTCGAGAAACTCCCAGAATCTACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133673.2-152s1c1
Sequence:CCGGCCTGTCCTATACCGATTTCTACTCGAGTAGAAATCGGTATAGGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133673.2-272s1c1
Sequence:CCGGCGAAGTGATTCTCAAGGCATTCTCGAGAATGCCTTGAGAATCACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133673.2-797s1c1
Sequence:CCGGCCTGTGGCACAGTGGGCTAATCTCGAGATTAGCCCACTGTGCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133673.2-431s1c1
Sequence:CCGGCCACCTGTTCGTCTCTACTTTCTCGAGAAAGTAGAGACGAACAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133673.3-596s21c1
Sequence:CCGGAGCCCTTCCTGGACTACTATGCTCGAGCATAGTAGTCCAGGAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133673.3-851s21c1
Sequence:CCGGTCCTGCCCTTGGAGTACAAACCTCGAGGTTTGTACTCCAAGGGCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133673.3-273s21c1
Sequence:CCGGCGAAGTGATTCTCAAGGCATTCTCGAGAATGCCTTGAGAATCACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133673.3-432s21c2
Sequence:CCGGCCACCTGTTCGTCTCTACTTTCTCGAGAAAGTAGAGACGAACAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351239    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133673.3-2003s21c2
Sequence:CCGGGCAGGTAGATTCTGGGAGTTTCTCGAGAAACTCCCAGAATCTACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133673
VALIDATED
TOR1B MISSION shRNA Lentiviral Transduction Particles
torsin family 1, member B (torsin B)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106485    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133673.2-2002s1c1
Sequence:CCGGGCAGGTAGATTCTGGGAGTTTCTCGAGAAACTCCCAGAATCTACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133673.2-152s1c1
Sequence:CCGGCCTGTCCTATACCGATTTCTACTCGAGTAGAAATCGGTATAGGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133673.2-272s1c1
Sequence:CCGGCGAAGTGATTCTCAAGGCATTCTCGAGAATGCCTTGAGAATCACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133673.2-797s1c1
Sequence:CCGGCCTGTGGCACAGTGGGCTAATCTCGAGATTAGCCCACTGTGCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133673.2-431s1c1
Sequence:CCGGCCACCTGTTCGTCTCTACTTTCTCGAGAAAGTAGAGACGAACAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133673.3-596s21c1
Sequence:CCGGAGCCCTTCCTGGACTACTATGCTCGAGCATAGTAGTCCAGGAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133673.3-851s21c1
Sequence:CCGGTCCTGCCCTTGGAGTACAAACCTCGAGGTTTGTACTCCAAGGGCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133673.3-273s21c1
Sequence:CCGGCGAAGTGATTCTCAAGGCATTCTCGAGAATGCCTTGAGAATCACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133673.3-432s21c2
Sequence:CCGGCCACCTGTTCGTCTCTACTTTCTCGAGAAAGTAGAGACGAACAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351239    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133673.3-2003s21c2
Sequence:CCGGGCAGGTAGATTCTGGGAGTTTCTCGAGAAACTCCCAGAATCTACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014506
VALIDATED
TOR1B MISSION shRNA Bacterial Glycerol Stock
torsin family 1, member B (torsin B)
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000165721    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_014506.1-1498s1c1
Sequence:CCGGCCGAGACAGAAGTACCTGAAACTCGAGTTTCAGGTACTTCTGTCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164797    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014506.1-356s1c1
Sequence:CCGGCCAAGAAACCACTGACCCTTTCTCGAGAAAGGGTCAGTGGTTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161556    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014506.1-474s1c1
Sequence:CCGGGTTTGTATCGACTCTGCACTTCTCGAGAAGTGCAGAGTCGATACAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_014506.1-612s1c1
Sequence:CCGGCGGGATCATTGACGCAATCAACTCGAGTTGATTGCGTCAATGATCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_014506.1-805s1c1
Sequence:CCGGGTCGGAGTCTTCAATAATAAACTCGAGTTTATTATTGAAGACTCCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_014506.1-807s1c1
Sequence:CCGGCGGAGTCTTCAATAATAAACACTCGAGTGTTTATTATTGAAGACTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158557    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014506.1-803s1c1
Sequence:CCGGCTGTCGGAGTCTTCAATAATACTCGAGTATTATTGAAGACTCCGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014506.1-718s21c1
Sequence:CCGGCTTATAACTAAGACGGCTCTTCTCGAGAAGAGCCGTCTTAGTTATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433244    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014506.1-1391s21c1
Sequence:CCGGGTGAATCTATTGCGCGCATTTCTCGAGAAATGCGCGCAATAGATTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014506.1-255s21c1
Sequence:CCGGTTCGGCTCTCAAGCTGGATTTCTCGAGAAATCCAGCTTGAGAGCCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014506.1-536s21c1
Sequence:CCGGAGAAGTGGATCCGCGGTAATGCTCGAGCATTACCGCGGATCCACTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014506.1-942s21c1
Sequence:CCGGCCGTGGTTCTGCCATAGATGACTCGAGTCATCTATGGCAGAACCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014506.1-299s21c1
Sequence:CCGGATCTAGCCACGGAAGTGATTTCTCGAGAAATCACTTCCGTGGCTAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014506
VALIDATED
TOR1B MISSION shRNA shRNA Plasmid DNA
torsin family 1, member B (torsin B)
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000165721    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_014506.1-1498s1c1
Sequence:CCGGCCGAGACAGAAGTACCTGAAACTCGAGTTTCAGGTACTTCTGTCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164797    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014506.1-356s1c1
Sequence:CCGGCCAAGAAACCACTGACCCTTTCTCGAGAAAGGGTCAGTGGTTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161556    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014506.1-474s1c1
Sequence:CCGGGTTTGTATCGACTCTGCACTTCTCGAGAAGTGCAGAGTCGATACAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_014506.1-612s1c1
Sequence:CCGGCGGGATCATTGACGCAATCAACTCGAGTTGATTGCGTCAATGATCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_014506.1-805s1c1
Sequence:CCGGGTCGGAGTCTTCAATAATAAACTCGAGTTTATTATTGAAGACTCCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_014506.1-807s1c1
Sequence:CCGGCGGAGTCTTCAATAATAAACACTCGAGTGTTTATTATTGAAGACTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158557    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014506.1-803s1c1
Sequence:CCGGCTGTCGGAGTCTTCAATAATACTCGAGTATTATTGAAGACTCCGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014506.1-718s21c1
Sequence:CCGGCTTATAACTAAGACGGCTCTTCTCGAGAAGAGCCGTCTTAGTTATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433244    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014506.1-1391s21c1
Sequence:CCGGGTGAATCTATTGCGCGCATTTCTCGAGAAATGCGCGCAATAGATTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014506.1-255s21c1
Sequence:CCGGTTCGGCTCTCAAGCTGGATTTCTCGAGAAATCCAGCTTGAGAGCCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014506.1-536s21c1
Sequence:CCGGAGAAGTGGATCCGCGGTAATGCTCGAGCATTACCGCGGATCCACTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014506.1-942s21c1
Sequence:CCGGCCGTGGTTCTGCCATAGATGACTCGAGTCATCTATGGCAGAACCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014506.1-299s21c1
Sequence:CCGGATCTAGCCACGGAAGTGATTTCTCGAGAAATCACTTCCGTGGCTAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014506
VALIDATED
TOR1B MISSION shRNA Lentiviral Transduction Particles
torsin family 1, member B (torsin B)
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000165721    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_014506.1-1498s1c1
Sequence:CCGGCCGAGACAGAAGTACCTGAAACTCGAGTTTCAGGTACTTCTGTCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164797    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014506.1-356s1c1
Sequence:CCGGCCAAGAAACCACTGACCCTTTCTCGAGAAAGGGTCAGTGGTTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161556    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014506.1-474s1c1
Sequence:CCGGGTTTGTATCGACTCTGCACTTCTCGAGAAGTGCAGAGTCGATACAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_014506.1-612s1c1
Sequence:CCGGCGGGATCATTGACGCAATCAACTCGAGTTGATTGCGTCAATGATCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_014506.1-805s1c1
Sequence:CCGGGTCGGAGTCTTCAATAATAAACTCGAGTTTATTATTGAAGACTCCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_014506.1-807s1c1
Sequence:CCGGCGGAGTCTTCAATAATAAACACTCGAGTGTTTATTATTGAAGACTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158557    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014506.1-803s1c1
Sequence:CCGGCTGTCGGAGTCTTCAATAATACTCGAGTATTATTGAAGACTCCGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014506.1-718s21c1
Sequence:CCGGCTTATAACTAAGACGGCTCTTCTCGAGAAGAGCCGTCTTAGTTATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433244    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014506.1-1391s21c1
Sequence:CCGGGTGAATCTATTGCGCGCATTTCTCGAGAAATGCGCGCAATAGATTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014506.1-255s21c1
Sequence:CCGGTTCGGCTCTCAAGCTGGATTTCTCGAGAAATCCAGCTTGAGAGCCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014506.1-536s21c1
Sequence:CCGGAGAAGTGGATCCGCGGTAATGCTCGAGCATTACCGCGGATCCACTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014506.1-942s21c1
Sequence:CCGGCCGTGGTTCTGCCATAGATGACTCGAGTCATCTATGGCAGAACCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014506.1-299s21c1
Sequence:CCGGATCTAGCCACGGAAGTGATTTCTCGAGAAATCACTTCCGTGGCTAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks