EMAIL THIS PAGE TO A FRIEND

TOR2A

torsin family 2, member A

Synonyms: TORP1
Gene ID:
Human(27433) Summary: This gene encodes a member of the AAA family of adenosine triphosphatases with similarity to Clp proteases and heat shock proteins. Alternative splicing at this locus results in the translation of multiple isoforms of the encoded protein, some of which contain salusin peptides in the C-terminal region. These peptides may play roles in hypotension, myocardial growth and the induction of mitogenesis, and may also be involved in the pathogenesis of atherosclerosis. [provided by RefSeq, Oct 2011]
Mouse(30933) torsin family 2, member A
Rat(362112) torsin family 2, member A
Zebrafish(559805) torsin family 2, member A
domestic cat(101092305) torsin family 2, member A
dog(609191) torsin family 2, member A
chicken(417224) torsin family 2, member A
cow(534311) torsin family 2, member A
sheep(101102798) torsin family 2, member A
domestic guinea pig(100726394) torsin family 2, member A
naked mole-rat(101726025) torsin family 2, member A
88 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1303525 ANTI-TOR2A (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing
AV50286 Anti-TOR2A antibody produced in rabbit IgG fraction of antiserum guinea pig, horse, rat, human, pig, mouse, bovine
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152800 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_152800 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_152800 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_130459 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_130459 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_130459 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU157581 MISSION® esiRNA esiRNA human TOR2A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001085347 Rosetta Predictions human pricing
NM_130459 Rosetta Predictions human pricing
NM_001007744 Rosetta Predictions rat pricing
NM_152800 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085347 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00317452 predicted 1290
2 SASI_Hs02_00317453 predicted 1262
3 SASI_Hs02_00317454 predicted 1161
4 SASI_Hs02_00317455 predicted 1100
5 SASI_Hs02_00317456 predicted 1013
6 SASI_Hs02_00317457 predicted 1260
7 SASI_Hs02_00317458 predicted 1017
8 SASI_Hs02_00317459 predicted 1159
9 SASI_Hs02_00317460 predicted 210
10 SASI_Hs02_00317461 predicted 1221
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130459 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00362749 predicted 207
2 SASI_Hs01_00055542 predicted 601
3 SASI_Hs01_00055543 predicted 447
4 SASI_Hs01_00055548 predicted 1239
5 SASI_Hs01_00055549 predicted 1229
6 SASI_Hs01_00055550 predicted 1277
7 SASI_Hs01_00055545 predicted 457
8 SASI_Hs02_00362750 predicted 797
9 SASI_Hs02_00362751 predicted 499
10 SASI_Hs02_00362752 predicted 838
11 SASI_Hs01_00055544 predicted 484
12 SASI_Hs01_00055546 predicted 415
13 SASI_Hs01_00055547 predicted 561
14 SASI_Hs01_00055551 predicted 738
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007744 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00074811 predicted 1028
2 SASI_Rn01_00074812 predicted 442
3 SASI_Rn01_00074813 predicted 398
4 SASI_Rn01_00074814 predicted 261
5 SASI_Rn01_00074815 predicted 264
6 SASI_Rn01_00074816 predicted 1137
7 SASI_Rn01_00074817 predicted 219
8 SASI_Rn01_00074818 predicted 1156
9 SASI_Rn01_00074820 predicted 1069
10 SASI_Rn02_00198937 predicted 1116
11 SASI_Rn01_00074819 predicted 951
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152800 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00030211 predicted 1093
2 SASI_Mm01_00030212 predicted 243
3 SASI_Mm01_00030213 predicted 1151
4 SASI_Mm02_00342798 predicted 340
5 SASI_Mm01_00030214 predicted 1022
6 SASI_Mm01_00030216 predicted 691
7 SASI_Mm01_00030217 predicted 1203
8 SASI_Mm01_00030218 predicted 678
9 SASI_Mm01_00030219 predicted 572
10 SASI_Mm01_00030220 predicted 1234
11 SASI_Mm01_00030215 predicted 1224
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152800
VALIDATED
TOR2A MISSION shRNA Bacterial Glycerol Stock
torsin family 2, member A
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000308689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152800.2-183s21c1
Sequence:CCGGCTGGAATGTGACCTGGCTCAACTCGAGTTGAGCCAGGTCACATTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152800.2-587s21c1
Sequence:CCGGGACCAACTATCGCAAAGCCATCTCGAGATGGCTTTGCGATAGTTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308618    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152800.2-1061s21c1
Sequence:CCGGCCTGGAAGAAATCTTTCCTAACTCGAGTTAGGAAAGATTTCTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152800.2-729s21c1
Sequence:CCGGGCTGTGATGGACAACCCTCAACTCGAGTTGAGGGTTGTCCATCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106460    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_152800.1-1061s1c1
Sequence:CCGGCCTGGAAGAAATCTTTCCTAACTCGAGTTAGGAAAGATTTCTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_152800.1-316s1c1
Sequence:CCGGGCACCGGGAAGTCCTACGTTACTCGAGTAACGTAGGACTTCCCGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_152800.1-183s1c1
Sequence:CCGGCTGGAATGTGACCTGGCTCAACTCGAGTTGAGCCAGGTCACATTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_152800.1-587s1c1
Sequence:CCGGGACCAACTATCGCAAAGCCATCTCGAGATGGCTTTGCGATAGTTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_152800.1-729s1c1
Sequence:CCGGGCTGTGATGGACAACCCTCAACTCGAGTTGAGGGTTGTCCATCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152800
VALIDATED
TOR2A MISSION shRNA shRNA Plasmid DNA
torsin family 2, member A
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000308689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152800.2-183s21c1
Sequence:CCGGCTGGAATGTGACCTGGCTCAACTCGAGTTGAGCCAGGTCACATTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152800.2-587s21c1
Sequence:CCGGGACCAACTATCGCAAAGCCATCTCGAGATGGCTTTGCGATAGTTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308618    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152800.2-1061s21c1
Sequence:CCGGCCTGGAAGAAATCTTTCCTAACTCGAGTTAGGAAAGATTTCTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152800.2-729s21c1
Sequence:CCGGGCTGTGATGGACAACCCTCAACTCGAGTTGAGGGTTGTCCATCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106460    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_152800.1-1061s1c1
Sequence:CCGGCCTGGAAGAAATCTTTCCTAACTCGAGTTAGGAAAGATTTCTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_152800.1-316s1c1
Sequence:CCGGGCACCGGGAAGTCCTACGTTACTCGAGTAACGTAGGACTTCCCGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_152800.1-183s1c1
Sequence:CCGGCTGGAATGTGACCTGGCTCAACTCGAGTTGAGCCAGGTCACATTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_152800.1-587s1c1
Sequence:CCGGGACCAACTATCGCAAAGCCATCTCGAGATGGCTTTGCGATAGTTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_152800.1-729s1c1
Sequence:CCGGGCTGTGATGGACAACCCTCAACTCGAGTTGAGGGTTGTCCATCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152800
VALIDATED
TOR2A MISSION shRNA Lentiviral Transduction Particles
torsin family 2, member A
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000308689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152800.2-183s21c1
Sequence:CCGGCTGGAATGTGACCTGGCTCAACTCGAGTTGAGCCAGGTCACATTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152800.2-587s21c1
Sequence:CCGGGACCAACTATCGCAAAGCCATCTCGAGATGGCTTTGCGATAGTTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308618    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152800.2-1061s21c1
Sequence:CCGGCCTGGAAGAAATCTTTCCTAACTCGAGTTAGGAAAGATTTCTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152800.2-729s21c1
Sequence:CCGGGCTGTGATGGACAACCCTCAACTCGAGTTGAGGGTTGTCCATCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106460    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_152800.1-1061s1c1
Sequence:CCGGCCTGGAAGAAATCTTTCCTAACTCGAGTTAGGAAAGATTTCTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_152800.1-316s1c1
Sequence:CCGGGCACCGGGAAGTCCTACGTTACTCGAGTAACGTAGGACTTCCCGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_152800.1-183s1c1
Sequence:CCGGCTGGAATGTGACCTGGCTCAACTCGAGTTGAGCCAGGTCACATTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_152800.1-587s1c1
Sequence:CCGGGACCAACTATCGCAAAGCCATCTCGAGATGGCTTTGCGATAGTTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_152800.1-729s1c1
Sequence:CCGGGCTGTGATGGACAACCCTCAACTCGAGTTGAGGGTTGTCCATCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_130459
TOR2A MISSION shRNA Bacterial Glycerol Stock
torsin family 2, member A
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166615    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130459.1-483s1c1
Sequence:CCGGCTCTTCCTCTTCGATGAGATGCTCGAGCATCTCATCGAAGAGGAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166187    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130459.1-423s1c1
Sequence:CCGGCGCTACAAGAAGGATCTGAAGCTCGAGCTTCAGATCCTTCTTGTAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165996    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130459.1-572s1c1
Sequence:CCGGGACCAATTACCGCAAAGCCATCTCGAGATGGCTTTGCGGTAATTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165582    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130459.1-422s1c1
Sequence:CCGGGCGCTACAAGAAGGATCTGAACTCGAGTTCAGATCCTTCTTGTAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165244    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130459.1-738s1c1
Sequence:CCGGGCCACTCTCAGAGATGACATTCTCGAGAATGTCATCTCTGAGAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158692    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_130459.1-2205s1c1
Sequence:CCGGGAGCCTTCTTACTGTGAATTACTCGAGTAATTCACAGTAAGAAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159498    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130459.1-744s1c1
Sequence:CCGGCTCAGAGATGACATTGTCATTCTCGAGAATGACAATGTCATCTCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159558    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_130459.1-2207s1c1
Sequence:CCGGGCCTTCTTACTGTGAATTATACTCGAGTATAATTCACAGTAAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160031    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130459.1-584s1c1
Sequence:CCGGCAAAGCCATCTTCATCTTCATCTCGAGATGAAGATGAAGATGGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160668    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130459.1-782s1c1
Sequence:CCGGCTTTGGACATTCTCAGCAAATCTCGAGATTTGCTGAGAATGTCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162079    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130459.1-491s1c1
Sequence:CCGGCTTCGATGAGATGGACAAGATCTCGAGATCTTGTCCATCTCATCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162588    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130459.1-781s1c1
Sequence:CCGGCCTTTGGACATTCTCAGCAAACTCGAGTTTGCTGAGAATGTCCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165275    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130459.1-750s1c1
Sequence:CCGGGATGACATTGTCATTCCGCCTCTCGAGAGGCGGAATGACAATGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166041    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130459.1-488s1c1
Sequence:CCGGCCTCTTCGATGAGATGGACAACTCGAGTTGTCCATCTCATCGAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_130459
TOR2A MISSION shRNA shRNA Plasmid DNA
torsin family 2, member A
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166615    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130459.1-483s1c1
Sequence:CCGGCTCTTCCTCTTCGATGAGATGCTCGAGCATCTCATCGAAGAGGAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166187    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130459.1-423s1c1
Sequence:CCGGCGCTACAAGAAGGATCTGAAGCTCGAGCTTCAGATCCTTCTTGTAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165996    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130459.1-572s1c1
Sequence:CCGGGACCAATTACCGCAAAGCCATCTCGAGATGGCTTTGCGGTAATTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165582    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130459.1-422s1c1
Sequence:CCGGGCGCTACAAGAAGGATCTGAACTCGAGTTCAGATCCTTCTTGTAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165244    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130459.1-738s1c1
Sequence:CCGGGCCACTCTCAGAGATGACATTCTCGAGAATGTCATCTCTGAGAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158692    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_130459.1-2205s1c1
Sequence:CCGGGAGCCTTCTTACTGTGAATTACTCGAGTAATTCACAGTAAGAAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159498    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130459.1-744s1c1
Sequence:CCGGCTCAGAGATGACATTGTCATTCTCGAGAATGACAATGTCATCTCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159558    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_130459.1-2207s1c1
Sequence:CCGGGCCTTCTTACTGTGAATTATACTCGAGTATAATTCACAGTAAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160031    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130459.1-584s1c1
Sequence:CCGGCAAAGCCATCTTCATCTTCATCTCGAGATGAAGATGAAGATGGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160668    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130459.1-782s1c1
Sequence:CCGGCTTTGGACATTCTCAGCAAATCTCGAGATTTGCTGAGAATGTCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162079    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130459.1-491s1c1
Sequence:CCGGCTTCGATGAGATGGACAAGATCTCGAGATCTTGTCCATCTCATCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162588    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130459.1-781s1c1
Sequence:CCGGCCTTTGGACATTCTCAGCAAACTCGAGTTTGCTGAGAATGTCCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165275    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130459.1-750s1c1
Sequence:CCGGGATGACATTGTCATTCCGCCTCTCGAGAGGCGGAATGACAATGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166041    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130459.1-488s1c1
Sequence:CCGGCCTCTTCGATGAGATGGACAACTCGAGTTGTCCATCTCATCGAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_130459
TOR2A MISSION shRNA Lentiviral Transduction Particles
torsin family 2, member A
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166615    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130459.1-483s1c1
Sequence:CCGGCTCTTCCTCTTCGATGAGATGCTCGAGCATCTCATCGAAGAGGAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166187    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130459.1-423s1c1
Sequence:CCGGCGCTACAAGAAGGATCTGAAGCTCGAGCTTCAGATCCTTCTTGTAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165996    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130459.1-572s1c1
Sequence:CCGGGACCAATTACCGCAAAGCCATCTCGAGATGGCTTTGCGGTAATTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165582    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130459.1-422s1c1
Sequence:CCGGGCGCTACAAGAAGGATCTGAACTCGAGTTCAGATCCTTCTTGTAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165244    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130459.1-738s1c1
Sequence:CCGGGCCACTCTCAGAGATGACATTCTCGAGAATGTCATCTCTGAGAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158692    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_130459.1-2205s1c1
Sequence:CCGGGAGCCTTCTTACTGTGAATTACTCGAGTAATTCACAGTAAGAAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159498    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130459.1-744s1c1
Sequence:CCGGCTCAGAGATGACATTGTCATTCTCGAGAATGACAATGTCATCTCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159558    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_130459.1-2207s1c1
Sequence:CCGGGCCTTCTTACTGTGAATTATACTCGAGTATAATTCACAGTAAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160031    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130459.1-584s1c1
Sequence:CCGGCAAAGCCATCTTCATCTTCATCTCGAGATGAAGATGAAGATGGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160668    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130459.1-782s1c1
Sequence:CCGGCTTTGGACATTCTCAGCAAATCTCGAGATTTGCTGAGAATGTCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162079    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130459.1-491s1c1
Sequence:CCGGCTTCGATGAGATGGACAAGATCTCGAGATCTTGTCCATCTCATCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162588    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130459.1-781s1c1
Sequence:CCGGCCTTTGGACATTCTCAGCAAACTCGAGTTTGCTGAGAATGTCCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165275    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130459.1-750s1c1
Sequence:CCGGGATGACATTGTCATTCCGCCTCTCGAGAGGCGGAATGACAATGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166041    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130459.1-488s1c1
Sequence:CCGGCCTCTTCGATGAGATGGACAACTCGAGTTGTCCATCTCATCGAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks