EMAIL THIS PAGE TO A FRIEND

TOR3A

torsin family 3, member A

Synonyms: ADIR ADIR2
Gene ID:
Mouse(30935) torsin family 3, member A
Rat(304884) torsin family 3, member A
naked mole-rat(101706652) torsin family 3, member A
domestic guinea pig(100717295) torsin family 3, member A
cow(789634) torsin family 3, member A
sheep(101120852) torsin family 3, member A
Zebrafish(792835) torsin family 3, member A
chicken(424426) torsin family 3, member A
dog(490326) torsin family 3, member A
Gene Class: Dehydratase
54 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV33117 Anti-TOR3A antibody produced in rabbit affinity isolated antibody zebrafish, human, horse, rat, guinea pig, bovine, rabbit, canine, mouse
western blot pricing
HPA028766 Anti-TOR3A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023141 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023141 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023141 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022371 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022371 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022371 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU078511 MISSION® esiRNA esiRNA human TOR3A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022371 Rosetta Predictions human pricing
NM_001009683 Rosetta Predictions rat pricing
NM_023141 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022371 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00059306 predicted 1228
2 SASI_Hs01_00059308 predicted 504
3 SASI_Hs01_00059309 predicted 1789
4 SASI_Hs01_00059310 predicted 1029
5 SASI_Hs01_00059311 predicted 452
6 SASI_Hs02_00355673 predicted 1023
7 SASI_Hs01_00059312 predicted 1309
8 SASI_Hs02_00355674 predicted 509
9 SASI_Hs01_00059314 predicted 976
10 SASI_Hs01_00059315 predicted 933
11 SASI_Hs01_00059307 predicted 832
12 SASI_Hs01_00059313 predicted 969
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009683 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00199734 predicted 1196
2 SASI_Rn01_00098942 predicted 609
3 SASI_Rn02_00199735 predicted 1086
4 SASI_Rn01_00098944 predicted 407
5 SASI_Rn01_00098945 predicted 355
6 SASI_Rn01_00098946 predicted 431
7 SASI_Rn01_00098947 predicted 572
8 SASI_Rn01_00098948 predicted 356
9 SASI_Rn01_00098949 predicted 968
10 SASI_Rn01_00098950 predicted 873
11 SASI_Rn01_00098943 predicted 342
12 SASI_Rn01_00098951 predicted 427
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023141 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00068043 predicted 941
2 SASI_Mm02_00326860 predicted 1072
3 SASI_Mm01_00068044 predicted 482
4 SASI_Mm01_00068045 predicted 325
5 SASI_Mm01_00068046 predicted 320
6 SASI_Mm01_00068047 predicted 1292
7 SASI_Mm01_00068048 predicted 403
8 SASI_Mm01_00068049 predicted 334
9 SASI_Mm01_00068050 predicted 1174
10 SASI_Mm01_00068051 predicted 1287
11 SASI_Mm01_00068052 predicted 1179
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023141
VALIDATED
TOR3A MISSION shRNA Bacterial Glycerol Stock
torsin family 3, member A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000115441    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023141.1-1778s1c1
Sequence:CCGGCCTCGTCATGTGCAATTAAATCTCGAGATTTAATTGCACATGACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023141.1-1052s1c1
Sequence:CCGGCCTGGATGAAATCGCCAAGATCTCGAGATCTTGGCGATTTCATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023141.1-311s1c1
Sequence:CCGGCGATTGCAGGATCTCCAACAACTCGAGTTGTTGGAGATCCTGCAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023141.1-941s1c1
Sequence:CCGGGAAACACCTTATTGACCACTTCTCGAGAAGTGGTCAATAAGGTGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023141.1-554s1c1
Sequence:CCGGGTTTATTTCTACCTTCCACTTCTCGAGAAGTGGAAGGTAGAAATAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023141
VALIDATED
TOR3A MISSION shRNA shRNA Plasmid DNA
torsin family 3, member A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000115441    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023141.1-1778s1c1
Sequence:CCGGCCTCGTCATGTGCAATTAAATCTCGAGATTTAATTGCACATGACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023141.1-1052s1c1
Sequence:CCGGCCTGGATGAAATCGCCAAGATCTCGAGATCTTGGCGATTTCATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023141.1-311s1c1
Sequence:CCGGCGATTGCAGGATCTCCAACAACTCGAGTTGTTGGAGATCCTGCAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023141.1-941s1c1
Sequence:CCGGGAAACACCTTATTGACCACTTCTCGAGAAGTGGTCAATAAGGTGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023141.1-554s1c1
Sequence:CCGGGTTTATTTCTACCTTCCACTTCTCGAGAAGTGGAAGGTAGAAATAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023141
VALIDATED
TOR3A MISSION shRNA Lentiviral Transduction Particles
torsin family 3, member A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000115441    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023141.1-1778s1c1
Sequence:CCGGCCTCGTCATGTGCAATTAAATCTCGAGATTTAATTGCACATGACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023141.1-1052s1c1
Sequence:CCGGCCTGGATGAAATCGCCAAGATCTCGAGATCTTGGCGATTTCATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023141.1-311s1c1
Sequence:CCGGCGATTGCAGGATCTCCAACAACTCGAGTTGTTGGAGATCCTGCAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023141.1-941s1c1
Sequence:CCGGGAAACACCTTATTGACCACTTCTCGAGAAGTGGTCAATAAGGTGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023141.1-554s1c1
Sequence:CCGGGTTTATTTCTACCTTCCACTTCTCGAGAAGTGGAAGGTAGAAATAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022371
VALIDATED
TOR3A MISSION shRNA Bacterial Glycerol Stock
torsin family 3, member A
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_022371.2-1161s1c1
Sequence:CCGGCCCAAGGAGGAACAACTCTTTCTCGAGAAAGAGTTGTTCCTCCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162513    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022371.2-1208s1c1
Sequence:CCGGCCAGAGGATTAACTACTTCCTCTCGAGAGGAAGTAGTTAATCCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162427    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022371.2-1527s1c1
Sequence:CCGGCCAAAGTGGAATGTGGTTGAACTCGAGTTCAACCACATTCCACTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161749    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022371.2-1196s1c1
Sequence:CCGGCAAGTCTATTTCCCAGAGGATCTCGAGATCCTCTGGGAAATAGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159046    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022371.2-391s1c1
Sequence:CCGGGCAGAATCTCCAACAACTTTACTCGAGTAAAGTTGTTGGAGATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161146    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022371.2-921s1c1
Sequence:CCGGCGGGAAGAAATTACGATGGAACTCGAGTTCCATCGTAATTTCTTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162481    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022371.2-1510s1c1
Sequence:CCGGCCTTAAAGACACGCATTCCAACTCGAGTTGGAATGCGTGTCTTTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163211    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022371.2-608s1c1
Sequence:CCGGGATGAGTGACTGTGTCAGGATCTCGAGATCCTGACACAGTCACTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022371.3-940s21c1
Sequence:CCGGAGTCTCCATGGACTATCTTTCCTCGAGGAAAGATAGTCCATGGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370695    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022371.3-1455s21c1
Sequence:CCGGATCCAGCAGCCACTAACAAACCTCGAGGTTTGTTAGTGGCTGCTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022371.3-990s21c1
Sequence:CCGGATCAATGAGGTGGTCCTAAAGCTCGAGCTTTAGGACCACCTCATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022371.3-1209s21c1
Sequence:CCGGAGCCAGGAGCTCCTGTATAAACTCGAGTTTATACAGGAGCTCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022371.3-1311s21c1
Sequence:CCGGTCTATTTCCCAGAGGATTAACCTCGAGGTTAATCCTCTGGGAAATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022371.3-742s21c1
Sequence:CCGGTCATCGCCACGTTCCACTTTCCTCGAGGAAAGTGGAACGTGGCGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365537    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022371.3-1697s21c1
Sequence:CCGGGCAAATCCCAAGGGCTTATTACTCGAGTAATAAGCCCTTGGGATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022371.3-1081s21c1
Sequence:CCGGTTGTGGAGACCATAGACAATGCTCGAGCATTGTCTATGGTCTCCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022371
VALIDATED
TOR3A MISSION shRNA shRNA Plasmid DNA
torsin family 3, member A
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_022371.2-1161s1c1
Sequence:CCGGCCCAAGGAGGAACAACTCTTTCTCGAGAAAGAGTTGTTCCTCCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162513    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022371.2-1208s1c1
Sequence:CCGGCCAGAGGATTAACTACTTCCTCTCGAGAGGAAGTAGTTAATCCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162427    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022371.2-1527s1c1
Sequence:CCGGCCAAAGTGGAATGTGGTTGAACTCGAGTTCAACCACATTCCACTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161749    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022371.2-1196s1c1
Sequence:CCGGCAAGTCTATTTCCCAGAGGATCTCGAGATCCTCTGGGAAATAGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159046    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022371.2-391s1c1
Sequence:CCGGGCAGAATCTCCAACAACTTTACTCGAGTAAAGTTGTTGGAGATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161146    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022371.2-921s1c1
Sequence:CCGGCGGGAAGAAATTACGATGGAACTCGAGTTCCATCGTAATTTCTTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162481    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022371.2-1510s1c1
Sequence:CCGGCCTTAAAGACACGCATTCCAACTCGAGTTGGAATGCGTGTCTTTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163211    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022371.2-608s1c1
Sequence:CCGGGATGAGTGACTGTGTCAGGATCTCGAGATCCTGACACAGTCACTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022371.3-940s21c1
Sequence:CCGGAGTCTCCATGGACTATCTTTCCTCGAGGAAAGATAGTCCATGGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370695    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022371.3-1455s21c1
Sequence:CCGGATCCAGCAGCCACTAACAAACCTCGAGGTTTGTTAGTGGCTGCTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022371.3-990s21c1
Sequence:CCGGATCAATGAGGTGGTCCTAAAGCTCGAGCTTTAGGACCACCTCATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022371.3-1209s21c1
Sequence:CCGGAGCCAGGAGCTCCTGTATAAACTCGAGTTTATACAGGAGCTCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022371.3-1311s21c1
Sequence:CCGGTCTATTTCCCAGAGGATTAACCTCGAGGTTAATCCTCTGGGAAATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022371.3-742s21c1
Sequence:CCGGTCATCGCCACGTTCCACTTTCCTCGAGGAAAGTGGAACGTGGCGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365537    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022371.3-1697s21c1
Sequence:CCGGGCAAATCCCAAGGGCTTATTACTCGAGTAATAAGCCCTTGGGATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022371.3-1081s21c1
Sequence:CCGGTTGTGGAGACCATAGACAATGCTCGAGCATTGTCTATGGTCTCCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022371
VALIDATED
TOR3A MISSION shRNA Lentiviral Transduction Particles
torsin family 3, member A
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_022371.2-1161s1c1
Sequence:CCGGCCCAAGGAGGAACAACTCTTTCTCGAGAAAGAGTTGTTCCTCCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162513    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022371.2-1208s1c1
Sequence:CCGGCCAGAGGATTAACTACTTCCTCTCGAGAGGAAGTAGTTAATCCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162427    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022371.2-1527s1c1
Sequence:CCGGCCAAAGTGGAATGTGGTTGAACTCGAGTTCAACCACATTCCACTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161749    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022371.2-1196s1c1
Sequence:CCGGCAAGTCTATTTCCCAGAGGATCTCGAGATCCTCTGGGAAATAGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159046    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022371.2-391s1c1
Sequence:CCGGGCAGAATCTCCAACAACTTTACTCGAGTAAAGTTGTTGGAGATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161146    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022371.2-921s1c1
Sequence:CCGGCGGGAAGAAATTACGATGGAACTCGAGTTCCATCGTAATTTCTTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162481    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022371.2-1510s1c1
Sequence:CCGGCCTTAAAGACACGCATTCCAACTCGAGTTGGAATGCGTGTCTTTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163211    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022371.2-608s1c1
Sequence:CCGGGATGAGTGACTGTGTCAGGATCTCGAGATCCTGACACAGTCACTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022371.3-940s21c1
Sequence:CCGGAGTCTCCATGGACTATCTTTCCTCGAGGAAAGATAGTCCATGGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370695    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022371.3-1455s21c1
Sequence:CCGGATCCAGCAGCCACTAACAAACCTCGAGGTTTGTTAGTGGCTGCTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022371.3-990s21c1
Sequence:CCGGATCAATGAGGTGGTCCTAAAGCTCGAGCTTTAGGACCACCTCATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022371.3-1209s21c1
Sequence:CCGGAGCCAGGAGCTCCTGTATAAACTCGAGTTTATACAGGAGCTCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022371.3-1311s21c1
Sequence:CCGGTCTATTTCCCAGAGGATTAACCTCGAGGTTAATCCTCTGGGAAATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022371.3-742s21c1
Sequence:CCGGTCATCGCCACGTTCCACTTTCCTCGAGGAAAGTGGAACGTGGCGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365537    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022371.3-1697s21c1
Sequence:CCGGGCAAATCCCAAGGGCTTATTACTCGAGTAATAAGCCCTTGGGATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022371.3-1081s21c1
Sequence:CCGGTTGTGGAGACCATAGACAATGCTCGAGCATTGTCTATGGTCTCCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks