EMAIL THIS PAGE TO A FRIEND

TOR4A

torsin family 4, member A

Synonyms: C9orf167
UniProtKB ID: Q9NXH8, A2BFA4
Gene ID:
Mouse(227612) torsin family 4, member A
Rat(311795) torsin family 4, member A
dog(491229) torsin family 4, member A
cow(618444) torsin family 4, member A
domestic guinea pig(100713758) torsin family 4, member A
naked mole-rat(101710687) torsin family 4, member A
43 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_146115 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146115 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146115 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017723 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017723 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017723 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU089791 MISSION® esiRNA esiRNA targeting mouse A830007P12Rik (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017723 Rosetta Predictions human pricing
NM_001107816 Rosetta Predictions rat pricing
NM_146115 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017723 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00129926 predicted 637
2 SASI_Hs01_00129927 predicted 542
3 SASI_Hs01_00129929 predicted 1502
4 SASI_Hs01_00129930 predicted 1541
5 SASI_Hs02_00350495 predicted 1466
6 SASI_Hs01_00129931 predicted 993
7 SASI_Hs01_00129932 predicted 1193
8 SASI_Hs01_00129933 predicted 551
9 SASI_Hs01_00129934 predicted 1215
10 SASI_Hs01_00129935 predicted 1687
11 SASI_Hs01_00129928 predicted 333
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107816 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00232555 predicted 747
2 SASI_Rn02_00232556 predicted 1673
3 SASI_Rn02_00232557 predicted 1716
4 SASI_Rn02_00232558 predicted 630
5 SASI_Rn02_00232559 predicted 444
6 SASI_Rn02_00232560 predicted 439
7 SASI_Rn02_00232561 predicted 641
8 SASI_Rn02_00232562 predicted 1097
9 SASI_Rn02_00232563 predicted 1119
10 SASI_Rn02_00232564 predicted 1128
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146115 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00178835 predicted 453
2 SASI_Mm01_00178836 predicted 560
3 SASI_Mm01_00178838 predicted 456
4 SASI_Mm01_00178839 predicted 684
5 SASI_Mm01_00178840 predicted 233
6 SASI_Mm01_00178841 predicted 1294
7 SASI_Mm01_00178842 predicted 255
8 SASI_Mm01_00178843 predicted 929
9 SASI_Mm01_00178844 predicted 914
10 SASI_Mm02_00341778 predicted 463
11 SASI_Mm01_00178837 predicted 1239
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146115
VALIDATED
TOR4A MISSION shRNA Bacterial Glycerol Stock
torsin family 4, member A
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000283031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146115.3-250s21c1
Sequence:CCGGCGACCTAGACCAACCTAAATTCTCGAGAATTTAGGTTGGTCTAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146115.3-708s21c1
Sequence:CCGGTGCAGTACCATGCACGATATCCTCGAGGATATCGTGCATGGTACTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146115.3-912s21c1
Sequence:CCGGATTTCCACAATGCTATCTATGCTCGAGCATAGATAGCATTGTGGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146115.3-455s21c1
Sequence:CCGGATTGAGAATCTAGACGATAATCTCGAGATTATCGTCTAGATTCTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283032    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146115.3-2815s21c1
Sequence:CCGGCGACTAAGTGAGGGTACAAACCTCGAGGTTTGTACCCTCACTTAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192019    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146115.2-260s1c1
Sequence:CCGGCCAACCTAAATTCTTCACCTTCTCGAGAAGGTGAAGAATTTAGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191189    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146115.2-454s1c1
Sequence:CCGGCCATTGAGAATCTAGACGATACTCGAGTATCGTCTAGATTCTCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146115
VALIDATED
TOR4A MISSION shRNA shRNA Plasmid DNA
torsin family 4, member A
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000283031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146115.3-250s21c1
Sequence:CCGGCGACCTAGACCAACCTAAATTCTCGAGAATTTAGGTTGGTCTAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146115.3-708s21c1
Sequence:CCGGTGCAGTACCATGCACGATATCCTCGAGGATATCGTGCATGGTACTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146115.3-912s21c1
Sequence:CCGGATTTCCACAATGCTATCTATGCTCGAGCATAGATAGCATTGTGGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146115.3-455s21c1
Sequence:CCGGATTGAGAATCTAGACGATAATCTCGAGATTATCGTCTAGATTCTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283032    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146115.3-2815s21c1
Sequence:CCGGCGACTAAGTGAGGGTACAAACCTCGAGGTTTGTACCCTCACTTAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192019    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146115.2-260s1c1
Sequence:CCGGCCAACCTAAATTCTTCACCTTCTCGAGAAGGTGAAGAATTTAGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191189    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146115.2-454s1c1
Sequence:CCGGCCATTGAGAATCTAGACGATACTCGAGTATCGTCTAGATTCTCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146115
VALIDATED
TOR4A MISSION shRNA Lentiviral Transduction Particles
torsin family 4, member A
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000283031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146115.3-250s21c1
Sequence:CCGGCGACCTAGACCAACCTAAATTCTCGAGAATTTAGGTTGGTCTAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146115.3-708s21c1
Sequence:CCGGTGCAGTACCATGCACGATATCCTCGAGGATATCGTGCATGGTACTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146115.3-912s21c1
Sequence:CCGGATTTCCACAATGCTATCTATGCTCGAGCATAGATAGCATTGTGGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146115.3-455s21c1
Sequence:CCGGATTGAGAATCTAGACGATAATCTCGAGATTATCGTCTAGATTCTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283032    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146115.3-2815s21c1
Sequence:CCGGCGACTAAGTGAGGGTACAAACCTCGAGGTTTGTACCCTCACTTAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192019    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146115.2-260s1c1
Sequence:CCGGCCAACCTAAATTCTTCACCTTCTCGAGAAGGTGAAGAATTTAGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191189    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146115.2-454s1c1
Sequence:CCGGCCATTGAGAATCTAGACGATACTCGAGTATCGTCTAGATTCTCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017723
TOR4A MISSION shRNA Bacterial Glycerol Stock
torsin family 4, member A
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000158309    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017723.1-3544s1c1
Sequence:CCGGCATCCACCTGTCAGTCAACAACTCGAGTTGTTGACTGACAGGTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156563    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017723.1-340s1c1
Sequence:CCGGGCCAAAGTTCTTCACCTTCGACTCGAGTCGAAGGTGAAGAACTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156681    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017723.1-1697s1c1
Sequence:CCGGGATGATCTCAGGGCCAACAATCTCGAGATTGTTGGCCCTGAGATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157734    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017723.1-337s1c1
Sequence:CCGGCCAGCCAAAGTTCTTCACCTTCTCGAGAAGGTGAAGAACTTTGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157389    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017723.1-3367s1c1
Sequence:CCGGGTGTTGGCTTCAAGGTGGTAACTCGAGTTACCACCTTGAAGCCAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157124    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017723.1-1919s1c1
Sequence:CCGGGCTGGAGTGTCTTGACAGTAACTCGAGTTACTGTCAAGACACTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017723.1-517s1c1
Sequence:CCGGCCAAGTTCTCAACGCTATCGACTCGAGTCGATAGCGTTGAGAACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017723.1-514s1c1
Sequence:CCGGCTTCCAAGTTCTCAACGCTATCTCGAGATAGCGTTGAGAACTTGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152998    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017723.1-3818s1c1
Sequence:CCGGGAGACGGTGATTCACTATGTTCTCGAGAACATAGTGAATCACCGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017723
TOR4A MISSION shRNA shRNA Plasmid DNA
torsin family 4, member A
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000158309    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017723.1-3544s1c1
Sequence:CCGGCATCCACCTGTCAGTCAACAACTCGAGTTGTTGACTGACAGGTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156563    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017723.1-340s1c1
Sequence:CCGGGCCAAAGTTCTTCACCTTCGACTCGAGTCGAAGGTGAAGAACTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156681    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017723.1-1697s1c1
Sequence:CCGGGATGATCTCAGGGCCAACAATCTCGAGATTGTTGGCCCTGAGATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157734    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017723.1-337s1c1
Sequence:CCGGCCAGCCAAAGTTCTTCACCTTCTCGAGAAGGTGAAGAACTTTGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157389    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017723.1-3367s1c1
Sequence:CCGGGTGTTGGCTTCAAGGTGGTAACTCGAGTTACCACCTTGAAGCCAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157124    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017723.1-1919s1c1
Sequence:CCGGGCTGGAGTGTCTTGACAGTAACTCGAGTTACTGTCAAGACACTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017723.1-517s1c1
Sequence:CCGGCCAAGTTCTCAACGCTATCGACTCGAGTCGATAGCGTTGAGAACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017723.1-514s1c1
Sequence:CCGGCTTCCAAGTTCTCAACGCTATCTCGAGATAGCGTTGAGAACTTGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152998    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017723.1-3818s1c1
Sequence:CCGGGAGACGGTGATTCACTATGTTCTCGAGAACATAGTGAATCACCGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017723
TOR4A MISSION shRNA Lentiviral Transduction Particles
torsin family 4, member A
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000158309    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017723.1-3544s1c1
Sequence:CCGGCATCCACCTGTCAGTCAACAACTCGAGTTGTTGACTGACAGGTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156563    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017723.1-340s1c1
Sequence:CCGGGCCAAAGTTCTTCACCTTCGACTCGAGTCGAAGGTGAAGAACTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156681    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017723.1-1697s1c1
Sequence:CCGGGATGATCTCAGGGCCAACAATCTCGAGATTGTTGGCCCTGAGATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157734    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017723.1-337s1c1
Sequence:CCGGCCAGCCAAAGTTCTTCACCTTCTCGAGAAGGTGAAGAACTTTGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157389    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017723.1-3367s1c1
Sequence:CCGGGTGTTGGCTTCAAGGTGGTAACTCGAGTTACCACCTTGAAGCCAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157124    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017723.1-1919s1c1
Sequence:CCGGGCTGGAGTGTCTTGACAGTAACTCGAGTTACTGTCAAGACACTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017723.1-517s1c1
Sequence:CCGGCCAAGTTCTCAACGCTATCGACTCGAGTCGATAGCGTTGAGAACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017723.1-514s1c1
Sequence:CCGGCTTCCAAGTTCTCAACGCTATCTCGAGATAGCGTTGAGAACTTGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152998    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017723.1-3818s1c1
Sequence:CCGGGAGACGGTGATTCACTATGTTCTCGAGAACATAGTGAATCACCGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks