EMAIL THIS PAGE TO A FRIEND

TOX2

TOX high mobility group box family member 2

Synonyms: C20orf100 GCX-1 GCX1 dJ1108D11.2 dJ495O3.1
Gene ID:
Mouse(269389) TOX high mobility group box family member 2
Rat(311615) TOX high mobility group box family member 2
naked mole-rat(101714433) TOX high mobility group box family member 2
domestic guinea pig(100719772) TOX high mobility group box family member 2
cow(519845) TOX high mobility group box family member 2
sheep(101107885) TOX high mobility group box family member 2
Zebrafish(405844) TOX high mobility group box family member 2
chicken(419156) TOX high mobility group box family member 2
domestic cat(101094749) TOX high mobility group box family member 2
Horse(100070714) TOX high mobility group box family member 2
dog(485880) TOX high mobility group box family member 2
135 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032883 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032883 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032883 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001098799 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001098799 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001098799 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098796 Rosetta Predictions human pricing
NM_001098797 Rosetta Predictions human pricing
NM_001098798 Rosetta Predictions human pricing
NM_032883 Rosetta Predictions human pricing
NM_199392 Rosetta Predictions rat pricing
NM_001098799 Rosetta Predictions mouse pricing
XM_001005899 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098796 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00319869 predicted 1534
2 SASI_Hs02_00319870 predicted 312
3 SASI_Hs02_00319871 predicted 392
4 SASI_Hs02_00319872 predicted 1530
5 SASI_Hs02_00319873 predicted 592
6 SASI_Hs02_00319874 predicted 444
7 SASI_Hs02_00319875 predicted 445
8 SASI_Hs02_00319876 predicted 778
9 SASI_Hs02_00319877 predicted 721
10 SASI_Hs02_00319878 predicted 928
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098797 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00319879 predicted 1609
2 SASI_Hs02_00319880 predicted 384
3 SASI_Hs02_00319881 predicted 464
4 SASI_Hs02_00319882 predicted 1610
5 SASI_Hs02_00319883 predicted 671
6 SASI_Hs02_00319884 predicted 520
7 SASI_Hs02_00319885 predicted 520
8 SASI_Hs02_00319886 predicted 847
9 SASI_Hs02_00319887 predicted 791
10 SASI_Hs02_00319888 predicted 1002
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098798 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00319889 predicted 1528
2 SASI_Hs02_00319890 predicted 390
3 SASI_Hs02_00319891 predicted 465
4 SASI_Hs02_00319892 predicted 1530
5 SASI_Hs02_00319893 predicted 671
6 SASI_Hs02_00319894 predicted 518
7 SASI_Hs02_00319895 predicted 518
8 SASI_Hs02_00319896 predicted 850
9 SASI_Hs02_00319897 predicted 802
10 SASI_Hs02_00319898 predicted 924
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032883 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00041527 predicted 1657
2 SASI_Hs01_00041532 predicted 430
3 SASI_Hs01_00041533 predicted 519
4 SASI_Hs02_00360503 predicted 1661
5 SASI_Hs02_00360504 predicted 721
6 SASI_Hs01_00041536 predicted 567
7 SASI_Hs02_00360505 predicted 573
8 SASI_Hs01_00041529 predicted 894
9 SASI_Hs01_00041531 predicted 847
10 SASI_Hs01_00041534 predicted 1057
11 SASI_Hs01_00041528 predicted 882
12 SASI_Hs01_00041530 predicted 481
13 SASI_Hs01_00041535 predicted 1067
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199392 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00083932 predicted 1722
2 SASI_Rn01_00083933 predicted 1012
3 SASI_Rn01_00083934 predicted 374
4 SASI_Rn01_00083936 predicted 1765
5 SASI_Rn01_00083937 predicted 770
6 SASI_Rn01_00083938 predicted 302
7 SASI_Rn01_00083939 predicted 1677
8 SASI_Rn01_00083940 predicted 909
9 SASI_Rn01_00083941 predicted 365
10 SASI_Rn02_00270215 predicted 659
11 SASI_Rn01_00083935 predicted 542
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098799 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00301451 predicted 1013
2 SASI_Mm02_00301452 predicted 843
3 SASI_Mm02_00301453 predicted 1007
4 SASI_Mm02_00301454 predicted 773
5 SASI_Mm02_00301455 predicted 377
6 SASI_Mm02_00301456 predicted 222
7 SASI_Mm02_00301457 predicted 761
8 SASI_Mm02_00301458 predicted 724
9 SASI_Mm02_00301459 predicted 298
10 SASI_Mm02_00301460 predicted 669
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001005899 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00212945 predicted 886
2 SASI_Mm01_00212946 predicted 648
3 SASI_Mm01_00212947 predicted 568
4 SASI_Mm01_00212948 predicted 418
5 SASI_Mm01_00212949 predicted 421
6 SASI_Mm01_00212950 predicted 212
7 SASI_Mm01_00212951 predicted 380
8 SASI_Mm01_00212952 predicted 493
9 SASI_Mm01_00212953 predicted 896
10 SASI_Mm01_00212954 predicted 542
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032883
VALIDATED
TOX2 MISSION shRNA Bacterial Glycerol Stock
TOX high mobility group box family member 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434191    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032883.2-2052s21c1
Sequence:CCGGGATTACGAAACCTAGAAACTGCTCGAGCAGTTTCTAGGTTTCGTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032883.2-996s21c1
Sequence:CCGGAGCAAAGAAGGAATATCTGAACTCGAGTTCAGATATTCCTTCTTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420740    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032883.2-2077s21c1
Sequence:CCGGTTCCGTGTAAGTAGTTGACTACTCGAGTAGTCAACTACTTACACGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423270    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032883.2-2015s21c1
Sequence:CCCGCATAGATGTGCACATCGGTTTCTCGAGAAACCGATGTGCACATCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032883.2-737s21c1
Sequence:CCGGATTTCAAGATCTCGGGAGAAACTCGAGTTTCTCCCGAGATCTTGAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032883.1-249s1c1
Sequence:CCGGAGCGAGAACAACGAAGACTATCTCGAGATAGTCTTCGTTGTTCTCGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032883.1-1312s1c1
Sequence:CCGGCCCTCCTCAGTCCACCTGTTACTCGAGTAACAGGTGGACTGAGGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032883.1-882s1c1
Sequence:CCGGACTTTCGGTGACGTGTCCAAACTCGAGTTTGGACACGTCACCGAAAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032883.1-1034s1c1
Sequence:CCGGCCCAGATCAAGGTGAGACCAACTCGAGTTGGTCTCACCTTGATCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032883.1-1568s1c1
Sequence:CCGGCAAATCGCTCTACCTCACCTACTCGAGTAGGTGAGGTAGAGCGATTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032883
VALIDATED
TOX2 MISSION shRNA shRNA Plasmid DNA
TOX high mobility group box family member 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434191    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032883.2-2052s21c1
Sequence:CCGGGATTACGAAACCTAGAAACTGCTCGAGCAGTTTCTAGGTTTCGTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032883.2-996s21c1
Sequence:CCGGAGCAAAGAAGGAATATCTGAACTCGAGTTCAGATATTCCTTCTTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420740    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032883.2-2077s21c1
Sequence:CCGGTTCCGTGTAAGTAGTTGACTACTCGAGTAGTCAACTACTTACACGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423270    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032883.2-2015s21c1
Sequence:CCCGCATAGATGTGCACATCGGTTTCTCGAGAAACCGATGTGCACATCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032883.2-737s21c1
Sequence:CCGGATTTCAAGATCTCGGGAGAAACTCGAGTTTCTCCCGAGATCTTGAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032883.1-249s1c1
Sequence:CCGGAGCGAGAACAACGAAGACTATCTCGAGATAGTCTTCGTTGTTCTCGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032883.1-1312s1c1
Sequence:CCGGCCCTCCTCAGTCCACCTGTTACTCGAGTAACAGGTGGACTGAGGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032883.1-882s1c1
Sequence:CCGGACTTTCGGTGACGTGTCCAAACTCGAGTTTGGACACGTCACCGAAAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032883.1-1034s1c1
Sequence:CCGGCCCAGATCAAGGTGAGACCAACTCGAGTTGGTCTCACCTTGATCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032883.1-1568s1c1
Sequence:CCGGCAAATCGCTCTACCTCACCTACTCGAGTAGGTGAGGTAGAGCGATTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032883
VALIDATED
TOX2 MISSION shRNA Lentiviral Transduction Particles
TOX high mobility group box family member 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434191    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032883.2-2052s21c1
Sequence:CCGGGATTACGAAACCTAGAAACTGCTCGAGCAGTTTCTAGGTTTCGTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032883.2-996s21c1
Sequence:CCGGAGCAAAGAAGGAATATCTGAACTCGAGTTCAGATATTCCTTCTTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420740    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032883.2-2077s21c1
Sequence:CCGGTTCCGTGTAAGTAGTTGACTACTCGAGTAGTCAACTACTTACACGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423270    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032883.2-2015s21c1
Sequence:CCCGCATAGATGTGCACATCGGTTTCTCGAGAAACCGATGTGCACATCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032883.2-737s21c1
Sequence:CCGGATTTCAAGATCTCGGGAGAAACTCGAGTTTCTCCCGAGATCTTGAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032883.1-249s1c1
Sequence:CCGGAGCGAGAACAACGAAGACTATCTCGAGATAGTCTTCGTTGTTCTCGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032883.1-1312s1c1
Sequence:CCGGCCCTCCTCAGTCCACCTGTTACTCGAGTAACAGGTGGACTGAGGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032883.1-882s1c1
Sequence:CCGGACTTTCGGTGACGTGTCCAAACTCGAGTTTGGACACGTCACCGAAAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032883.1-1034s1c1
Sequence:CCGGCCCAGATCAAGGTGAGACCAACTCGAGTTGGTCTCACCTTGATCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032883.1-1568s1c1
Sequence:CCGGCAAATCGCTCTACCTCACCTACTCGAGTAGGTGAGGTAGAGCGATTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001098799
TOX2 MISSION shRNA Bacterial Glycerol Stock
TOX high mobility group box family member 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098799.1-663s21c1
Sequence:CCGGGAGGAATCAGATGCCCATTTCCTCGAGGAAATGGGCATCTGATTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098799.1-903s21c1
Sequence:CCGGGAGCAGAAACAGGCGTATAAGCTCGAGCTTATACGCCTGTTTCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098799.1-118s21c1
Sequence:CCGGGTGCGTCTCTGCAGAAGTTTGCTCGAGCAAACTTCTGCAGAGACGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098799.1-189s21c1
Sequence:CCGGTCAACCAGCCAGACCTATAACCTCGAGGTTATAGGTCTGGCTGGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098799.1-217s21c1
Sequence:CCGGGCGAGAGTAACGAAGACTATGCTCGAGCATAGTCTTCGTTACTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001098799
TOX2 MISSION shRNA shRNA Plasmid DNA
TOX high mobility group box family member 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098799.1-663s21c1
Sequence:CCGGGAGGAATCAGATGCCCATTTCCTCGAGGAAATGGGCATCTGATTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098799.1-903s21c1
Sequence:CCGGGAGCAGAAACAGGCGTATAAGCTCGAGCTTATACGCCTGTTTCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098799.1-118s21c1
Sequence:CCGGGTGCGTCTCTGCAGAAGTTTGCTCGAGCAAACTTCTGCAGAGACGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098799.1-189s21c1
Sequence:CCGGTCAACCAGCCAGACCTATAACCTCGAGGTTATAGGTCTGGCTGGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098799.1-217s21c1
Sequence:CCGGGCGAGAGTAACGAAGACTATGCTCGAGCATAGTCTTCGTTACTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001098799
TOX2 MISSION shRNA Lentiviral Transduction Particles
TOX high mobility group box family member 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098799.1-663s21c1
Sequence:CCGGGAGGAATCAGATGCCCATTTCCTCGAGGAAATGGGCATCTGATTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098799.1-903s21c1
Sequence:CCGGGAGCAGAAACAGGCGTATAAGCTCGAGCTTATACGCCTGTTTCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098799.1-118s21c1
Sequence:CCGGGTGCGTCTCTGCAGAAGTTTGCTCGAGCAAACTTCTGCAGAGACGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098799.1-189s21c1
Sequence:CCGGTCAACCAGCCAGACCTATAACCTCGAGGTTATAGGTCTGGCTGGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098799.1-217s21c1
Sequence:CCGGGCGAGAGTAACGAAGACTATGCTCGAGCATAGTCTTCGTTACTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks