EMAIL THIS PAGE TO A FRIEND

TOX3

TOX high mobility group box family member 3

Synonyms: CAGF9 TNRC9
UniProtKB ID: O15405, B4DRD0, B5MCW4
Gene ID:
Human(27324) Summary: The protein encoded by this gene contains an HMG-box, indicating that it may be involved in bending and unwinding of DNA and alteration of chromatin structure. The C-terminus of the encoded protein is glutamine-rich due to CAG repeats in the coding sequence. A minor allele of this gene has been implicated in an elevated risk of breast cancer. Two transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Apr 2009]
Mouse(244579) TOX high mobility group box family member 3
Rat(291908) TOX high mobility group box family member 3
Zebrafish(555286) TOX high mobility group box family member 3
Horse(100059910) TOX high mobility group box family member 3
domestic cat(101097364) TOX high mobility group box family member 3
dog(487281) TOX high mobility group box family member 3
chicken(415724) TOX high mobility group box family member 3
cow(539135) TOX high mobility group box family member 3
sheep(101117611) TOX high mobility group box family member 3
domestic guinea pig(100733069) TOX high mobility group box family member 3
naked mole-rat(101704440) TOX high mobility group box family member 3
144 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172913 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172913 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172913 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001080430 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080430 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080430 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080430 Rosetta Predictions human pricing
XM_049037 Rosetta Predictions human pricing
XM_931515 Rosetta Predictions human pricing
XM_931523 Rosetta Predictions human pricing
NM_001106171 Rosetta Predictions rat pricing
NM_172913 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080430 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00314766 predicted 422
2 SASI_Hs02_00314767 predicted 528
3 SASI_Hs02_00314768 predicted 412
4 SASI_Hs02_00314769 predicted 372
5 SASI_Hs02_00314770 predicted 577
6 SASI_Hs02_00314771 predicted 1948
7 SASI_Hs02_00314772 predicted 587
8 SASI_Hs02_00314773 predicted 428
9 SASI_Hs02_00314774 predicted 508
10 SASI_Hs02_00314775 predicted 503
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_049037 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00285780 predicted 2018
2 SASI_Hs01_00285781 predicted 1972
3 SASI_Hs01_00285782 predicted 2159
4 SASI_Hs01_00285783 predicted 1959
5 SASI_Hs01_00285784 predicted 412
6 SASI_Hs01_00285785 predicted 1987
7 SASI_Hs01_00285786 predicted 372
8 SASI_Hs01_00285787 predicted 2086
9 SASI_Hs01_00285788 predicted 2058
10 SASI_Hs01_00285789 predicted 2161
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931515 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00289393 predicted 2076
2 SASI_Hs01_00289394 predicted 2022
3 SASI_Hs01_00289395 predicted 2210
4 SASI_Hs01_00289396 predicted 2005
5 SASI_Hs01_00289397 predicted 463
6 SASI_Hs01_00289398 predicted 2050
7 SASI_Hs01_00289399 predicted 424
8 SASI_Hs01_00289400 predicted 2139
9 SASI_Hs01_00289401 predicted 2112
10 SASI_Hs01_00289402 predicted 2214
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931523 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00258923 predicted 2309
2 SASI_Hs01_00258924 predicted 2262
3 SASI_Hs01_00258925 predicted 2243
4 SASI_Hs01_00258926 predicted 2269
5 SASI_Hs01_00258927 predicted 2220
6 SASI_Hs01_00258928 predicted 2259
7 SASI_Hs01_00258929 predicted 2283
8 SASI_Hs01_00258930 predicted 2317
9 SASI_Hs01_00258931 predicted 2381
10 SASI_Hs01_00258932 predicted 2615
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106171 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00216328 predicted 259
2 SASI_Rn02_00216329 predicted 343
3 SASI_Rn02_00216330 predicted 1702
4 SASI_Rn02_00216331 predicted 314
5 SASI_Rn02_00216332 predicted 246
6 SASI_Rn02_00216333 predicted 318
7 SASI_Rn02_00216334 predicted 364
8 SASI_Rn02_00216335 predicted 1728
9 SASI_Rn02_00216336 predicted 352
10 SASI_Rn02_00216337 predicted 1688
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172913 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00085244 predicted 1355
2 SASI_Mm01_00085245 predicted 668
3 SASI_Mm01_00085246 predicted 1332
4 SASI_Mm01_00085247 predicted 655
5 SASI_Mm02_00344903 predicted 705
6 SASI_Mm01_00085251 predicted 2073
7 SASI_Mm01_00085252 predicted 1361
8 SASI_Mm01_00085253 predicted 747
9 SASI_Mm02_00344904 predicted 2104
10 SASI_Mm02_00344905 predicted 573
11 SASI_Mm01_00085248 predicted 737
12 SASI_Mm01_00085249 predicted 504
13 SASI_Mm01_00085250 predicted 2115
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172913
TOX3 MISSION shRNA Bacterial Glycerol Stock
TOX high mobility group box family member 3
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000081813    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172913.1-2725s1c1
Sequence:CCGGGCCCATTATGTTCATTCCAATCTCGAGATTGGAATGAACATAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172913.1-1459s1c1
Sequence:CCGGCTTAACCATGAGACTACCCATCTCGAGATGGGTAGTCTCATGGTTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172913.1-1106s1c1
Sequence:CCGGCAGGCTGCAATTAAGGGTCAACTCGAGTTGACCCTTAATTGCAGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172913.1-419s1c1
Sequence:CCGGGAGGCAAACAACGCCTTCTTTCTCGAGAAAGAAGGCGTTGTTTGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172913.1-656s1c1
Sequence:CCGGAGGAATCTGGTGGAGCAAGATCTCGAGATCTTGCTCCACCAGATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426734    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172913.3-2148s21c1
Sequence:CCGGTGTCTATTAGATAGGCAATAACTCGAGTTATTGCCTATCTAATAGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172913.3-2005s21c1
Sequence:CCGGGTGTTACCGCAGGTCAGTATTCTCGAGAATACTGACCTGCGGTAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172913
TOX3 MISSION shRNA shRNA Plasmid DNA
TOX high mobility group box family member 3
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000081813    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172913.1-2725s1c1
Sequence:CCGGGCCCATTATGTTCATTCCAATCTCGAGATTGGAATGAACATAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172913.1-1459s1c1
Sequence:CCGGCTTAACCATGAGACTACCCATCTCGAGATGGGTAGTCTCATGGTTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172913.1-1106s1c1
Sequence:CCGGCAGGCTGCAATTAAGGGTCAACTCGAGTTGACCCTTAATTGCAGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172913.1-419s1c1
Sequence:CCGGGAGGCAAACAACGCCTTCTTTCTCGAGAAAGAAGGCGTTGTTTGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172913.1-656s1c1
Sequence:CCGGAGGAATCTGGTGGAGCAAGATCTCGAGATCTTGCTCCACCAGATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426734    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172913.3-2148s21c1
Sequence:CCGGTGTCTATTAGATAGGCAATAACTCGAGTTATTGCCTATCTAATAGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172913.3-2005s21c1
Sequence:CCGGGTGTTACCGCAGGTCAGTATTCTCGAGAATACTGACCTGCGGTAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172913
TOX3 MISSION shRNA Lentiviral Transduction Particles
TOX high mobility group box family member 3
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000081813    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172913.1-2725s1c1
Sequence:CCGGGCCCATTATGTTCATTCCAATCTCGAGATTGGAATGAACATAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172913.1-1459s1c1
Sequence:CCGGCTTAACCATGAGACTACCCATCTCGAGATGGGTAGTCTCATGGTTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172913.1-1106s1c1
Sequence:CCGGCAGGCTGCAATTAAGGGTCAACTCGAGTTGACCCTTAATTGCAGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172913.1-419s1c1
Sequence:CCGGGAGGCAAACAACGCCTTCTTTCTCGAGAAAGAAGGCGTTGTTTGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172913.1-656s1c1
Sequence:CCGGAGGAATCTGGTGGAGCAAGATCTCGAGATCTTGCTCCACCAGATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426734    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172913.3-2148s21c1
Sequence:CCGGTGTCTATTAGATAGGCAATAACTCGAGTTATTGCCTATCTAATAGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172913.3-2005s21c1
Sequence:CCGGGTGTTACCGCAGGTCAGTATTCTCGAGAATACTGACCTGCGGTAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080430
TOX3 MISSION shRNA Bacterial Glycerol Stock
TOX high mobility group box family member 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000237899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080430.1-973s21c1
Sequence:CCGGGACACACAGGCTGCAATTAAACTCGAGTTTAATTGCAGCCTGTGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000237901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080430.1-1930s21c1
Sequence:CCGGGGGACATACTGATGACTATAACTCGAGTTATAGTCATCAGTATGTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000237903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080430.1-1861s21c1
Sequence:CCGGCAGACACAGACTCAAGTATTACTCGAGTAATACTTGAGTCTGTGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000237902    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080430.1-2304s21c1
Sequence:CCGGGACCACTGTTAGCCCATTATACTCGAGTATAATGGGCTAACAGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000237900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080430.1-1385s21c1
Sequence:CCGGCCAACATGCCCTCGAACATTGCTCGAGCAATGTTCGAGGGCATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080430
TOX3 MISSION shRNA shRNA Plasmid DNA
TOX high mobility group box family member 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000237899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080430.1-973s21c1
Sequence:CCGGGACACACAGGCTGCAATTAAACTCGAGTTTAATTGCAGCCTGTGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000237901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080430.1-1930s21c1
Sequence:CCGGGGGACATACTGATGACTATAACTCGAGTTATAGTCATCAGTATGTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000237903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080430.1-1861s21c1
Sequence:CCGGCAGACACAGACTCAAGTATTACTCGAGTAATACTTGAGTCTGTGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000237902    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080430.1-2304s21c1
Sequence:CCGGGACCACTGTTAGCCCATTATACTCGAGTATAATGGGCTAACAGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000237900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080430.1-1385s21c1
Sequence:CCGGCCAACATGCCCTCGAACATTGCTCGAGCAATGTTCGAGGGCATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080430
TOX3 MISSION shRNA Lentiviral Transduction Particles
TOX high mobility group box family member 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000237899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080430.1-973s21c1
Sequence:CCGGGACACACAGGCTGCAATTAAACTCGAGTTTAATTGCAGCCTGTGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000237901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080430.1-1930s21c1
Sequence:CCGGGGGACATACTGATGACTATAACTCGAGTTATAGTCATCAGTATGTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000237903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080430.1-1861s21c1
Sequence:CCGGCAGACACAGACTCAAGTATTACTCGAGTAATACTTGAGTCTGTGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000237902    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080430.1-2304s21c1
Sequence:CCGGGACCACTGTTAGCCCATTATACTCGAGTATAATGGGCTAACAGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000237900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080430.1-1385s21c1
Sequence:CCGGCCAACATGCCCTCGAACATTGCTCGAGCAATGTTCGAGGGCATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks