EMAIL THIS PAGE TO A FRIEND

TOX4

TOX high mobility group box family member 4

Synonyms: C14orf92 KIAA0737 LCP1 MIG7
UniProtKB ID: O94842
Gene ID:
Mouse(268741) TOX high mobility group box family member 4
Rat(286990) TOX high mobility group box family member 4
naked mole-rat(101700262) TOX high mobility group box family member 4
Domestic Rabbit(100358633) TOX high mobility group box family member 4
domestic guinea pig(100718233) TOX high mobility group box family member 4
cow(515314) TOX high mobility group box family member 4
sheep(101108312) TOX high mobility group box family member 4
Goat(100860964) TOX high mobility group box family member 4
Zebrafish(559853) TOX high mobility group box family member 4
domestic cat(101099052) TOX high mobility group box family member 4
dog(475403) TOX high mobility group box family member 4
193 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2107965 Anti-KIAA0737 antibody produced in rabbit IgG fraction of antiserum bovine, human, guinea pig, rabbit, canine, pig, rat, goat, zebrafish, mouse
western blot pricing
AV39144 Anti-KIAA0737 antibody produced in rabbit IgG fraction of antiserum, lyophilized powder , mouse, bovine, pig, chicken, canine, zebrafish, human, rat
western blot pricing
HPA017880 Anti-TOX4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution rat, human, mouse
immunofluorescence, immunohistochemistry, western blot pricing
HPA027551 Anti-TOX4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023434 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023434 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023434 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014828 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014828 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014828 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU200211 MISSION® esiRNA esiRNA targeting mouse Tox4 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014828 Rosetta Predictions human pricing
NM_173324 Rosetta Predictions rat pricing
NM_023434 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014828 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00144437 predicted 1873
2 SASI_Hs01_00144438 predicted 1237
3 SASI_Hs01_00144439 predicted 1851
4 SASI_Hs01_00144440 predicted 1191
5 SASI_Hs01_00144441 predicted 1224
6 SASI_Hs01_00144442 predicted 797
7 SASI_Hs01_00144443 predicted 476
8 SASI_Hs01_00144444 predicted 1534
9 SASI_Hs01_00144445 predicted 1536
10 SASI_Hs01_00144446 predicted 1137
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173324 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00099943 predicted 1072
2 SASI_Rn01_00099944 predicted 1823
3 SASI_Rn01_00099945 predicted 1261
4 SASI_Rn01_00099946 predicted 474
5 SASI_Rn01_00099947 predicted 810
6 SASI_Rn02_00269435 predicted 955
7 SASI_Rn01_00099948 predicted 1812
8 SASI_Rn02_00269436 predicted 487
9 SASI_Rn01_00099950 predicted 587
10 SASI_Rn01_00099951 predicted 445
11 SASI_Rn01_00099949 predicted 779
12 SASI_Rn01_00099952 predicted 437
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023434 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00327116 predicted 769
2 SASI_Mm02_00327117 predicted 772
3 SASI_Mm02_00327118 predicted 1960
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023434
VALIDATED
TOX4 MISSION shRNA Bacterial Glycerol Stock
TOX high mobility group box family member 4
Mouse
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000379072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023434.3-1426s21c1
Sequence:CCGGCTGGAGGTCAGCCCAATATTACTCGAGTAATATTGGGCTGACCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023434.3-874s21c1
Sequence:CCGGCTACTCCTTCACCTACCAATTCTCGAGAATTGGTAGGTGAAGGAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023434.3-666s21c1
Sequence:CCGGATGGACCTGGACCATTCTATACTCGAGTATAGAATGGTCCAGGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023434.3-765s21c1
Sequence:CCGGAGCCAGTTGACCACTATTGATCTCGAGATCAATAGTGGTCAACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023434.3-1706s21c1
Sequence:CCGGCCCAACTCAACAGCAAGTAACCTCGAGGTTACTTGCTGTTGAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023434.3-2190s21c1
Sequence:CCGGTCTGTGGTGTTTGTGAAGTAGCTCGAGCTACTTCACAAACACCACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235924    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023434.3-3772s21c1
Sequence:CCGGCTAAGTGGAAAGCCATAATTTCTCGAGAAATTATGGCTTTCCACTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023434.3-1959s21c1
Sequence:CCGGGAAATGATCGCAGATGTAGTTCTCGAGAACTACATCTGCGATCATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374289    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023434.3-2658s21c1
Sequence:CCGGTAGAAGAAACATACCAGTAAACTCGAGTTTACTGGTATGTTTCTTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023434.3-737s21c1
Sequence:CCGGAGACATGACATCTGGCTTAATCTCGAGATTAAGCCAGATGTCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023434.1-458s1c1
Sequence:CCGGGTTCTCAACTTGGTTTGAGTTCTCGAGAACTCAAACCAAGTTGAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023434.1-80s1c1
Sequence:CCGGCCGAGACATTCCATACACCAACTCGAGTTGGTGTATGGAATGTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084518    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023434.1-2205s1c1
Sequence:CCGGGCCAGCAAATTCACTGTAATTCTCGAGAATTACAGTGAATTTGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023434.1-901s1c1
Sequence:CCGGGCTACTGTGGAAACAGTGGAACTCGAGTTCCACTGTTTCCACAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023434.1-874s1c1
Sequence:CCGGGCTTATAAAGACAACCAGGAACTCGAGTTCCTGGTTGTCTTTATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023434
VALIDATED
TOX4 MISSION shRNA shRNA Plasmid DNA
TOX high mobility group box family member 4
Mouse
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000379072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023434.3-1426s21c1
Sequence:CCGGCTGGAGGTCAGCCCAATATTACTCGAGTAATATTGGGCTGACCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023434.3-874s21c1
Sequence:CCGGCTACTCCTTCACCTACCAATTCTCGAGAATTGGTAGGTGAAGGAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023434.3-666s21c1
Sequence:CCGGATGGACCTGGACCATTCTATACTCGAGTATAGAATGGTCCAGGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023434.3-765s21c1
Sequence:CCGGAGCCAGTTGACCACTATTGATCTCGAGATCAATAGTGGTCAACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023434.3-1706s21c1
Sequence:CCGGCCCAACTCAACAGCAAGTAACCTCGAGGTTACTTGCTGTTGAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023434.3-2190s21c1
Sequence:CCGGTCTGTGGTGTTTGTGAAGTAGCTCGAGCTACTTCACAAACACCACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235924    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023434.3-3772s21c1
Sequence:CCGGCTAAGTGGAAAGCCATAATTTCTCGAGAAATTATGGCTTTCCACTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023434.3-1959s21c1
Sequence:CCGGGAAATGATCGCAGATGTAGTTCTCGAGAACTACATCTGCGATCATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374289    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023434.3-2658s21c1
Sequence:CCGGTAGAAGAAACATACCAGTAAACTCGAGTTTACTGGTATGTTTCTTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023434.3-737s21c1
Sequence:CCGGAGACATGACATCTGGCTTAATCTCGAGATTAAGCCAGATGTCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023434.1-458s1c1
Sequence:CCGGGTTCTCAACTTGGTTTGAGTTCTCGAGAACTCAAACCAAGTTGAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023434.1-80s1c1
Sequence:CCGGCCGAGACATTCCATACACCAACTCGAGTTGGTGTATGGAATGTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084518    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023434.1-2205s1c1
Sequence:CCGGGCCAGCAAATTCACTGTAATTCTCGAGAATTACAGTGAATTTGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023434.1-901s1c1
Sequence:CCGGGCTACTGTGGAAACAGTGGAACTCGAGTTCCACTGTTTCCACAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023434.1-874s1c1
Sequence:CCGGGCTTATAAAGACAACCAGGAACTCGAGTTCCTGGTTGTCTTTATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023434
VALIDATED
TOX4 MISSION shRNA Lentiviral Transduction Particles
TOX high mobility group box family member 4
Mouse
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000379072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023434.3-1426s21c1
Sequence:CCGGCTGGAGGTCAGCCCAATATTACTCGAGTAATATTGGGCTGACCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023434.3-874s21c1
Sequence:CCGGCTACTCCTTCACCTACCAATTCTCGAGAATTGGTAGGTGAAGGAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023434.3-666s21c1
Sequence:CCGGATGGACCTGGACCATTCTATACTCGAGTATAGAATGGTCCAGGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023434.3-765s21c1
Sequence:CCGGAGCCAGTTGACCACTATTGATCTCGAGATCAATAGTGGTCAACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023434.3-1706s21c1
Sequence:CCGGCCCAACTCAACAGCAAGTAACCTCGAGGTTACTTGCTGTTGAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023434.3-2190s21c1
Sequence:CCGGTCTGTGGTGTTTGTGAAGTAGCTCGAGCTACTTCACAAACACCACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235924    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023434.3-3772s21c1
Sequence:CCGGCTAAGTGGAAAGCCATAATTTCTCGAGAAATTATGGCTTTCCACTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023434.3-1959s21c1
Sequence:CCGGGAAATGATCGCAGATGTAGTTCTCGAGAACTACATCTGCGATCATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374289    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023434.3-2658s21c1
Sequence:CCGGTAGAAGAAACATACCAGTAAACTCGAGTTTACTGGTATGTTTCTTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023434.3-737s21c1
Sequence:CCGGAGACATGACATCTGGCTTAATCTCGAGATTAAGCCAGATGTCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023434.1-458s1c1
Sequence:CCGGGTTCTCAACTTGGTTTGAGTTCTCGAGAACTCAAACCAAGTTGAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023434.1-80s1c1
Sequence:CCGGCCGAGACATTCCATACACCAACTCGAGTTGGTGTATGGAATGTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084518    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023434.1-2205s1c1
Sequence:CCGGGCCAGCAAATTCACTGTAATTCTCGAGAATTACAGTGAATTTGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023434.1-901s1c1
Sequence:CCGGGCTACTGTGGAAACAGTGGAACTCGAGTTCCACTGTTTCCACAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023434.1-874s1c1
Sequence:CCGGGCTTATAAAGACAACCAGGAACTCGAGTTCCTGGTTGTCTTTATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014828
VALIDATED
TOX4 MISSION shRNA Bacterial Glycerol Stock
TOX high mobility group box family member 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000336842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014828.2-1754s21c1
Sequence:CCGGCCTTCTCAGATGGATGTTGAACTCGAGTTCAACATCCATCTGAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014828.2-758s21c1
Sequence:CCGGGATCCTAATGAACCTCAGAAACTCGAGTTTCTGAGGTTCATTAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336843    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014828.2-2175s21c1
Sequence:CCGGTTCAACCATAAGCGGTAATAGCTCGAGCTATTACCGCTTATGGTTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014828.2-174s21c1
Sequence:CCGGCCGAGACATTCCATACACCAACTCGAGTTGGTGTATGGAATGTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_014828.1-687s1c1
Sequence:CCGGGATCCTAATGAACCTCAGAAACTCGAGTTTCTGAGGTTCATTAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142672    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014828.1-3908s1c1
Sequence:CCGGCCAGGGAGTATTCTTTGGATACTCGAGTATCCAAAGAATACTCCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141194    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014828.1-700s1c1
Sequence:CCGGCTCAGAAACCAGTTTCAGCATCTCGAGATGCTGAAACTGGTTTCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142121    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014828.1-2963s1c1
Sequence:CCGGGCCCAGCTAATTTGTGGTATTCTCGAGAATACCACAAATTAGCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014828.1-1683s1c1
Sequence:CCGGCCTTCTCAGATGGATGTTGAACTCGAGTTCAACATCCATCTGAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_014828.1-103s1c1
Sequence:CCGGCCGAGACATTCCATACACCAACTCGAGTTGGTGTATGGAATGTCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014828
VALIDATED
TOX4 MISSION shRNA shRNA Plasmid DNA
TOX high mobility group box family member 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000336842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014828.2-1754s21c1
Sequence:CCGGCCTTCTCAGATGGATGTTGAACTCGAGTTCAACATCCATCTGAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014828.2-758s21c1
Sequence:CCGGGATCCTAATGAACCTCAGAAACTCGAGTTTCTGAGGTTCATTAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336843    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014828.2-2175s21c1
Sequence:CCGGTTCAACCATAAGCGGTAATAGCTCGAGCTATTACCGCTTATGGTTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014828.2-174s21c1
Sequence:CCGGCCGAGACATTCCATACACCAACTCGAGTTGGTGTATGGAATGTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_014828.1-687s1c1
Sequence:CCGGGATCCTAATGAACCTCAGAAACTCGAGTTTCTGAGGTTCATTAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142672    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014828.1-3908s1c1
Sequence:CCGGCCAGGGAGTATTCTTTGGATACTCGAGTATCCAAAGAATACTCCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141194    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014828.1-700s1c1
Sequence:CCGGCTCAGAAACCAGTTTCAGCATCTCGAGATGCTGAAACTGGTTTCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142121    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014828.1-2963s1c1
Sequence:CCGGGCCCAGCTAATTTGTGGTATTCTCGAGAATACCACAAATTAGCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014828.1-1683s1c1
Sequence:CCGGCCTTCTCAGATGGATGTTGAACTCGAGTTCAACATCCATCTGAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_014828.1-103s1c1
Sequence:CCGGCCGAGACATTCCATACACCAACTCGAGTTGGTGTATGGAATGTCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014828
VALIDATED
TOX4 MISSION shRNA Lentiviral Transduction Particles
TOX high mobility group box family member 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000336842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014828.2-1754s21c1
Sequence:CCGGCCTTCTCAGATGGATGTTGAACTCGAGTTCAACATCCATCTGAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014828.2-758s21c1
Sequence:CCGGGATCCTAATGAACCTCAGAAACTCGAGTTTCTGAGGTTCATTAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336843    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014828.2-2175s21c1
Sequence:CCGGTTCAACCATAAGCGGTAATAGCTCGAGCTATTACCGCTTATGGTTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014828.2-174s21c1
Sequence:CCGGCCGAGACATTCCATACACCAACTCGAGTTGGTGTATGGAATGTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_014828.1-687s1c1
Sequence:CCGGGATCCTAATGAACCTCAGAAACTCGAGTTTCTGAGGTTCATTAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142672    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014828.1-3908s1c1
Sequence:CCGGCCAGGGAGTATTCTTTGGATACTCGAGTATCCAAAGAATACTCCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141194    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014828.1-700s1c1
Sequence:CCGGCTCAGAAACCAGTTTCAGCATCTCGAGATGCTGAAACTGGTTTCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142121    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014828.1-2963s1c1
Sequence:CCGGGCCCAGCTAATTTGTGGTATTCTCGAGAATACCACAAATTAGCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014828.1-1683s1c1
Sequence:CCGGCCTTCTCAGATGGATGTTGAACTCGAGTTCAACATCCATCTGAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_014828.1-103s1c1
Sequence:CCGGCCGAGACATTCCATACACCAACTCGAGTTGGTGTATGGAATGTCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks