EMAIL THIS PAGE TO A FRIEND

TOX

thymocyte selection-associated high mobility group box

Synonyms: TOX1
UniProtKB ID: O94900, Q96AV5
Gene ID:
Human(9760) Summary: The protein encoded by this gene contains a HMG box DNA binding domain. HMG boxes are found in many eukaryotic proteins involved in chromatin assembly, transcription and replication. This protein may function to regulate T-cell development.[provided by RefSeq, Apr 2009]
Mouse(252838) thymocyte selection-associated high mobility group box
Rat(362481) thymocyte selection-associated high mobility group box
Zebrafish(569666) thymocyte selection-associated high mobility group box
domestic cat(101082974) thymocyte selection-associated high mobility group box
Horse(100052782) thymocyte selection-associated high mobility group box
dog(486964) thymocyte selection-associated high mobility group box
chicken(421138) thymocyte selection-associated high mobility group box
cow(525888) thymocyte selection-associated high mobility group box
sheep(101117675) thymocyte selection-associated high mobility group box
domestic guinea pig(100721130) thymocyte selection-associated high mobility group box
naked mole-rat(101699419) thymocyte selection-associated high mobility group box
Domestic Rabbit(100347559) thymocyte selection-associated high mobility group box
174 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_376776 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_376776 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_376776 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145711 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145711 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145711 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014729 Rosetta Predictions human pricing
NM_001108654 Rosetta Predictions rat pricing
NM_145711 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014729 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00069212 predicted 1619
2 SASI_Hs01_00069213 predicted 1825
3 SASI_Hs01_00069214 predicted 415
4 SASI_Hs01_00069215 predicted 1788
5 SASI_Hs01_00069216 predicted 1371
6 SASI_Hs01_00069217 predicted 1626
7 SASI_Hs01_00069218 predicted 1667
8 SASI_Hs01_00069219 predicted 1868
9 SASI_Hs01_00069220 predicted 1808
10 SASI_Hs01_00069221 predicted 1783
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108654 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00240759 predicted 1618
2 SASI_Rn02_00240760 predicted 402
3 SASI_Rn02_00240761 predicted 1811
4 SASI_Rn02_00240762 predicted 523
5 SASI_Rn02_00240763 predicted 1393
6 SASI_Rn02_00240764 predicted 1316
7 SASI_Rn02_00240765 predicted 403
8 SASI_Rn02_00240766 predicted 550
9 SASI_Rn02_00240767 predicted 595
10 SASI_Rn02_00240768 predicted 1401
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145711 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00081728 predicted 818
2 SASI_Mm01_00081730 predicted 1106
3 SASI_Mm01_00081731 predicted 1066
4 SASI_Mm01_00081732 predicted 623
5 SASI_Mm01_00081733 predicted 796
6 SASI_Mm01_00081734 predicted 1423
7 SASI_Mm01_00081735 predicted 1283
8 SASI_Mm02_00341263 predicted 1788
9 SASI_Mm01_00081736 predicted 1621
10 SASI_Mm01_00081737 predicted 991
11 SASI_Mm01_00081729 predicted 1647
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_376776
VALIDATED
TOX MISSION shRNA Bacterial Glycerol Stock
thymocyte selection-associated high mobility group box
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000019474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376776.1-1357s1c1
Sequence:CCGGCGGGAATGAATCCTCACCTAACTCGAGTTAGGTGAGGATTCATTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376776.1-306s1c1
Sequence:CCGGCCCTACTATTGCAACAAGTTTCTCGAGAAACTTGTTGCAATAGTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_376776.1-899s1c1
Sequence:CCGGCGATGATACCTCTAAGATCAACTCGAGTTGATCTTAGAGGTATCATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_376776.1-1631s1c1
Sequence:CCGGCGACTATCAGACTATTATCAACTCGAGTTGATAATAGTCTGATAGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_376776.1-566s1c1
Sequence:CCGGCCCTGAAATCACAGTCTCCAACTCGAGTTGGAGACTGTGATTTCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_376776
VALIDATED
TOX MISSION shRNA shRNA Plasmid DNA
thymocyte selection-associated high mobility group box
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000019474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376776.1-1357s1c1
Sequence:CCGGCGGGAATGAATCCTCACCTAACTCGAGTTAGGTGAGGATTCATTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376776.1-306s1c1
Sequence:CCGGCCCTACTATTGCAACAAGTTTCTCGAGAAACTTGTTGCAATAGTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_376776.1-899s1c1
Sequence:CCGGCGATGATACCTCTAAGATCAACTCGAGTTGATCTTAGAGGTATCATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_376776.1-1631s1c1
Sequence:CCGGCGACTATCAGACTATTATCAACTCGAGTTGATAATAGTCTGATAGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_376776.1-566s1c1
Sequence:CCGGCCCTGAAATCACAGTCTCCAACTCGAGTTGGAGACTGTGATTTCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_376776
VALIDATED
TOX MISSION shRNA Lentiviral Transduction Particles
thymocyte selection-associated high mobility group box
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000019474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376776.1-1357s1c1
Sequence:CCGGCGGGAATGAATCCTCACCTAACTCGAGTTAGGTGAGGATTCATTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376776.1-306s1c1
Sequence:CCGGCCCTACTATTGCAACAAGTTTCTCGAGAAACTTGTTGCAATAGTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_376776.1-899s1c1
Sequence:CCGGCGATGATACCTCTAAGATCAACTCGAGTTGATCTTAGAGGTATCATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_376776.1-1631s1c1
Sequence:CCGGCGACTATCAGACTATTATCAACTCGAGTTGATAATAGTCTGATAGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_376776.1-566s1c1
Sequence:CCGGCCCTGAAATCACAGTCTCCAACTCGAGTTGGAGACTGTGATTTCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145711
TOX MISSION shRNA Bacterial Glycerol Stock
thymocyte selection-associated high mobility group box
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000084178    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145711.2-2045s1c1
Sequence:CCGGCCATTCTGATTTCTGTTGGTTCTCGAGAACCAACAGAAATCAGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145711.2-1077s1c1
Sequence:CCGGGCCAGAATCCAAATGCTACTTCTCGAGAAGTAGCATTTGGATTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145711.2-1289s1c1
Sequence:CCGGGTCAACTCAAAGCCGTCAGTACTCGAGTACTGACGGCTTTGAGTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145711.2-1074s1c1
Sequence:CCGGAGGGCCAGAATCCAAATGCTACTCGAGTAGCATTTGGATTCTGGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145711.2-1340s1c1
Sequence:CCGGCTGTACCTAAGTTCTCACTATCTCGAGATAGTGAGAACTTAGGTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145711.4-1144s21c1
Sequence:CCGGAGAACAGAAACAGGTCTATAACTCGAGTTATAGACCTGTTTCTGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145711.4-912s21c1
Sequence:CCGGAGGATGCCTCCAAGATCAATGCTCGAGCATTGATCTTGGAGGCATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145711.4-1785s21c1
Sequence:CCGGAGAGGGACAAAGCGCTGTATCCTCGAGGATACAGCGCTTTGTCCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145711
TOX MISSION shRNA shRNA Plasmid DNA
thymocyte selection-associated high mobility group box
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000084178    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145711.2-2045s1c1
Sequence:CCGGCCATTCTGATTTCTGTTGGTTCTCGAGAACCAACAGAAATCAGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145711.2-1077s1c1
Sequence:CCGGGCCAGAATCCAAATGCTACTTCTCGAGAAGTAGCATTTGGATTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145711.2-1289s1c1
Sequence:CCGGGTCAACTCAAAGCCGTCAGTACTCGAGTACTGACGGCTTTGAGTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145711.2-1074s1c1
Sequence:CCGGAGGGCCAGAATCCAAATGCTACTCGAGTAGCATTTGGATTCTGGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145711.2-1340s1c1
Sequence:CCGGCTGTACCTAAGTTCTCACTATCTCGAGATAGTGAGAACTTAGGTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145711.4-1144s21c1
Sequence:CCGGAGAACAGAAACAGGTCTATAACTCGAGTTATAGACCTGTTTCTGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145711.4-912s21c1
Sequence:CCGGAGGATGCCTCCAAGATCAATGCTCGAGCATTGATCTTGGAGGCATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145711.4-1785s21c1
Sequence:CCGGAGAGGGACAAAGCGCTGTATCCTCGAGGATACAGCGCTTTGTCCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145711
TOX MISSION shRNA Lentiviral Transduction Particles
thymocyte selection-associated high mobility group box
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000084178    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145711.2-2045s1c1
Sequence:CCGGCCATTCTGATTTCTGTTGGTTCTCGAGAACCAACAGAAATCAGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145711.2-1077s1c1
Sequence:CCGGGCCAGAATCCAAATGCTACTTCTCGAGAAGTAGCATTTGGATTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145711.2-1289s1c1
Sequence:CCGGGTCAACTCAAAGCCGTCAGTACTCGAGTACTGACGGCTTTGAGTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145711.2-1074s1c1
Sequence:CCGGAGGGCCAGAATCCAAATGCTACTCGAGTAGCATTTGGATTCTGGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145711.2-1340s1c1
Sequence:CCGGCTGTACCTAAGTTCTCACTATCTCGAGATAGTGAGAACTTAGGTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145711.4-1144s21c1
Sequence:CCGGAGAACAGAAACAGGTCTATAACTCGAGTTATAGACCTGTTTCTGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145711.4-912s21c1
Sequence:CCGGAGGATGCCTCCAAGATCAATGCTCGAGCATTGATCTTGGAGGCATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145711.4-1785s21c1
Sequence:CCGGAGAGGGACAAAGCGCTGTATCCTCGAGGATACAGCGCTTTGTCCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks