EMAIL THIS PAGE TO A FRIEND

TP53

tumor protein p53

Synonyms: BCC7 LFS1 P53 TRP53
Gene ID:
Human(7157) Summary: This gene encodes a tumor suppressor protein containing transcriptional activation, DNA binding, and oligomerization domains. The encoded protein responds to diverse cellular stresses to regulate expression of target genes, thereby inducing cell cycle arrest, apoptosis, senescence, DNA repair, or changes in metabolism. Mutations in this gene are associated with a variety of human cancers, including hereditary cancers such as Li-Fraumeni syndrome. Alternative splicing of this gene and the use of alternate promoters result in multiple transcript variants and isoforms. Additional isoforms have also been shown to result from the use of alternate translation initiation codons (PMIDs: 12032546, 20937277). [provided by RefSeq, Feb 2013]
Rat(24842) tumor protein p53
Zebrafish(30590) tumor protein p53
Horse(100062044) tumor protein p53
domestic cat(493847) tumor protein p53
dog(403869) tumor protein p53
chicken(396200) tumor protein p53
cow(281542) tumor protein p53
sheep(443421) tumor protein p53
domestic guinea pig(100379269) tumor protein p53
Domestic Rabbit(100009292) tumor protein p53
naked mole-rat(101701769) tumor protein p53
228 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4503014 Anti-p53 (Acetyl-Lys317), C-Terminal antibody produced in rabbit affinity isolated antibody mouse, human, rat
immunofluorescence, western blot pricing
SAB4503018 Anti-p53 (Acetyl-Lys379), C-Terminal antibody produced in rabbit affinity isolated antibody human, mouse, rat
immunofluorescence, immunohistochemistry pricing
SAB4503020 Anti-p53 (Acetyl-Lys386), C-Terminal antibody produced in rabbit affinity isolated antibody human
immunofluorescence, immunohistochemistry pricing
SAB1306667 ANTI-P53 (S15) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB1306713 ANTI-P53 (S315) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB1306623 ANTI-P53 (SUMOYLATION SITE SPECIFIC) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1306675 ANTI-P53 (T55) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4503015 Anti-p53 antibody produced in rabbit affinity isolated antibody rat, human, mouse
immunohistochemistry, western blot pricing
SAB2702417 Anti-p53 antibody produced in rabbit affinity isolated antibody zebrafish
western blot pricing
P4235 Anti-p53 antibody produced in sheep fractionated antiserum, buffered aqueous solution rat, human, mouse
immunohistochemistry, immunoprecipitation, western blot pricing
SAB5500156 Anti-P53 antibody, Rabbit monoclonal recombinant, expressed in proprietary host, clone SP161, affinity isolated antibody human (tested)
immunohistochemistry pricing
SAB5500157 Anti-P53 antibody, Rabbit monoclonal clone SP5, recombinant, expressed in proprietary host, tissue culture supernatant human (tested)
immunohistochemistry pricing
SAB1306006 ANTI-P53(C-TERMINAL) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB4503001 Anti-p53, C-Terminal antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
SAB4503003 Anti-p53, C-Terminal antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing
SAB4503010 Anti-p53, C-Terminal antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing
SAB4503011 Anti-p53, C-Terminal antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, western blot pricing
SAB4503012 Anti-p53, C-Terminal antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, western blot pricing
SAB4503013 Anti-p53, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, western blot pricing
SAB4503019 Anti-p53, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, western blot pricing
SAB4503021 Anti-p53, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, rat, human
immunohistochemistry, western blot pricing
SAB4503000 Anti-p53, N-Terminal antibody produced in rabbit affinity isolated antibody human, rat, mouse
immunohistochemistry, western blot pricing
SAB4503002 Anti-p53, N-Terminal antibody produced in rabbit affinity isolated antibody human, rat
immunohistochemistry, western blot pricing
SAB4503004 Anti-p53, N-Terminal antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing
SAB4503005 Anti-p53, N-Terminal antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing
SAB4503006 Anti-p53, N-Terminal antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing
SAB4503007 Anti-p53, N-Terminal antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
SAB4503008 Anti-p53, N-Terminal antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing
SAB4503009 Anti-p53, N-Terminal antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, western blot pricing
SAB4504499 Anti-phospho-p53 (pSer15) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry, immunoprecipitation, western blot pricing
SAB4503953 Anti-phospho-p53 (pSer20) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
SAB4301516 Anti-phospho-p53 (pSer20) antibody produced in rabbit affinity isolated antibody mouse, human
western blot pricing
SAB4504500 Anti-phospho-p53 (pSer315) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry, immunoprecipitation, western blot pricing
SAB4504501 Anti-phospho-p53 (pSer33) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, western blot pricing
SAB4504592 Anti-phospho-p53 (pSer366) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB4301559 Anti-phospho-p53 (pSer366) antibody produced in rabbit affinity isolated antibody rat, human
western blot pricing
SAB4504502 Anti-phospho-p53 (pSer37) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB4504593 Anti-phospho-p53 (pSer378) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry, western blot pricing
P8982 Anti-phospho-p53 (pSer392) antibody produced in rabbit affinity isolated antibody, buffered aqueous glycerol solution mouse, human
microarray, western blot pricing
SAB4503954 Anti-phospho-p53 (pSer392) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB4301466 Anti-phospho-p53 (pSer392) antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB4504503 Anti-phospho-p53 (pSer46) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, western blot pricing
SAB4504504 Anti-phospho-p53 (pSer6) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, immunoprecipitation, western blot pricing
SAB4504505 Anti-phospho-p53 (pSer9) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, western blot pricing
SAB4504506 Anti-phospho-p53 (pThr18) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB4504591 Anti-phospho-p53 (pThr387) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry pricing
SAB4301280 Anti-phospho-p53 (pThr387) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry pricing
SAB1306688 ANTI-PHOSPHO-P53(S20) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB1305629 ANTI-PHOSPHO-P53(S315) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry pricing
SAB1306689 ANTI-PHOSPHO-P53(S376) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB1306606 ANTI-PHOSPHO-P53(S9) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB1306609 ANTI-PHOSPHO-P53(T18) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse
immunohistochemistry, western blot pricing
SAB1305574 ANTI-PHOSPHO-P53(T55) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
pricing
SAB4300073 Anti-phospho-TP53 (pSer15) antibody produced in rabbit affinity isolated antibody human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4300079 Anti-phospho-TP53 (pSer315) antibody produced in rabbit affinity isolated antibody human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4300076 Anti-phospho-TP53 (pSer33) antibody produced in rabbit affinity isolated antibody human
immunofluorescence, western blot pricing
SAB4300077 Anti-phospho-TP53 (pSer37) antibody produced in rabbit affinity isolated antibody human
immunofluorescence, western blot pricing
SAB4300078 Anti-phospho-TP53 (pSer46) antibody produced in rabbit affinity isolated antibody human
immunofluorescence, western blot pricing
SAB4300072 Anti-phospho-TP53 (pSer6) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
SAB4300074 Anti-phospho-TP53 (pThr18) antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB4300364 Anti-TP53 (Ab-15) antibody produced in rabbit affinity isolated antibody human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4300365 Anti-TP53 (Ab-18) antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB4300369 Anti-TP53 (Ab-315) antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB4300366 Anti-TP53 (Ab-33) antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB4300367 Anti-TP53 (Ab-37) antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB4300368 Anti-TP53 (Ab-46) antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB4300362 Anti-TP53 (Ab-6) antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB4300363 Anti-TP53 (Ab-9) antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB2102511 Anti-TP53 (ab1) antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB2102512 Anti-TP53 (ab2) antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB2102513 Anti-TP53 (ab3) antibody produced in rabbit affinity isolated antibody sheep, horse, rabbit, human, bovine, pig, rabbit, guinea pig
western blot pricing
SAB2102514 Anti-TP53 (ab4) antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB2102515 Anti-TP53 (ab5) antibody produced in rabbit affinity isolated antibody rabbit, rabbit, pig, sheep, guinea pig, horse, human, bovine
western blot pricing
SAB1406544 Anti-TP53 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
AV02055 Anti-TP53 antibody produced in rabbit IgG fraction of antiserum horse, human, rat
western blot pricing
HPA051244 Anti-TP53 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, western blot pricing
SAB5100004 Imprint® ChIP-Validated Monoclonal Anti-p53 (BP53-12) antibody produced in mouse clone BP53-12, isotype IgG2a, ascites fluid human
ChIP, western blot pricing
SAB5100001 Imprint® ChIP-Validated Monoclonal Anti-p53 (DO-1) antibody produced in mouse clone DO-1, purified immunoglobulin human
ChIP, western blot pricing
SAB5100002 Imprint® ChIP-Validated Monoclonal Anti-p53 (DO-7) antibody produced in mouse clone DO-7, purified immunoglobulin, isotype IgG2b human
ChIP, western blot pricing
SAB5100003 Imprint® ChIP-Validated Monoclonal Anti-p53 (PAb1801) antibody produced in mouse clone PAb1801, isotype IgG1, purified immunoglobulin human
ChIP, western blot pricing
P6749 Monoclonal Anti-p53 antibody produced in mouse clone PAb1801, purified from hybridoma cell culture human
ELISA, immunohistochemistry, immunoprecipitation, western blot pricing
AMAB90956 Monoclonal Anti-p53 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL2199, purified immunoglobulin, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
P5813 Monoclonal Anti-p53 antibody produced in mouse clone BP53-12, ascites fluid human
ELISA, immunocytochemistry, immunohistochemistry, immunoprecipitation, microarray, western blot pricing
P8999 Monoclonal Anti-p53 antibody produced in mouse clone DO-7, purified from hybridoma cell culture human
ELISA, immunocytochemistry, immunohistochemistry, immunoprecipitation, western blot pricing
P7874 Monoclonal Anti-p53 antibody produced in mouse ~2 mg/mL, clone DO-2, purified immunoglobulin, buffered aqueous solution human
immunoprecipitation, western blot pricing
P6874 Monoclonal Anti-p53 antibody produced in mouse clone DO-1, purified from hybridoma cell culture human
ELISA, flow cytometry, immunocytochemistry, immunohistochemistry, immunoprecipitation, microarray, western blot pricing
P9249 Monoclonal Anti-p53−Biotin antibody produced in mouse ~1 mg/mL, clone DO-1, ascites fluid, buffered aqueous solution human
flow cytometry, immunocytochemistry, immunohistochemistry, immunoprecipitation, western blot pricing
P9124 Monoclonal Anti-p53−Peroxidase antibody produced in mouse 2-4 mg/mL, clone DO-1, purified immunoglobulin, buffered aqueous solution human
western blot pricing
WH0007157M1 Monoclonal Anti-TP53 antibody produced in mouse clone 2C3, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1404483 Monoclonal Anti-TP53 antibody produced in mouse clone 2C11, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
PLA0072 Rabbit anti-p53 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. human, gorilla, chimpanzee
flow cytometry, immunofluorescence, immunohistochemistry, immunoprecipitation, proximity ligation assay, western blot pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
PZ0115 CP-31398 dihydrochloride hydrate ≥98% (HPLC) human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000546 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000546 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000546 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU123221 MISSION® esiRNA esiRNA human TP53 (esiRNA1) human pricing

Related Products

Product # Description Species Add to Cart
 
06-758 Anti-acetyl-p53 Antibody (Lys373, Lys382) 200 µL, Detect acetyl-p53 (Lys373) with Anti-acetyl-p53 Antibody (Lys373, Lys382) (Rabbit Polyclonal Antibody), that has been shown to work in WB. pricing
ABE286 Anti-acetyl-p53 (Lys120) Antibody 200 µg, Anti-acetyl-p53 (Lys120) Antibody is a highly specific rabbit polyclonal antibody, that targets p53 & has been tested in Dot Blot & IP. pricing
06-916 Anti-acetyl-p53 (Lys373) Antibody 200 µL, Anti-acetyl-p53 (Lys373) Antibody is a Rabbit Polyclonal Antibody for detection of acetyl-p53 (Lys373) also known as Antigen NY-CO-13, Phosphoprotein p53, Tumor suppressor p53, p53 antigen & has been tested in IP & WB. pricing
CBL404 Anti-p53 Antibody, aa 211-220, clone240 100 µg, Detect p53 with Anti-p53 Antibody, aa 211-220, clone240 (Mouse Monoclonal Antibody), that has been shown to work in IP, WB & IHC. pricing
05-224 Anti-p53 Antibody, clone BP53-12 200 µL, Anti-p53 Antibody, clone BP53-12 is a high quality Mouse Monoclonal Antibody for the detection of p53 & has been validated in IHC, IP & WB. pricing
MABE283 Anti-p53 Antibody, clone PAb421 100 µg, Use Anti-p53 Antibody, clone PAb421 (Mouse Monoclonal Antibody) validated in WB, IP, IHC to detect p53 also known as Cellular tumor antigen p53, Tumor suppressor p53. pricing
MABE327 Anti-p53 (pantropic) Antibody, clone DO-1 100 µg, Use Anti-p53 (pantropic) Antibody, clone DO-1 (Mouse Monoclonal Antibody) validated in WB, ICC, IHC, IF, IP to detect p53 (pantropic) also known as Cellular tumor antigen p53 or Antigen NY-CO-13. pricing
MABE339 Anti-p53 (wild type) Antibody, clone PAb1620 100 µg, Anti-p53 (wild type) Antibody, clone PAb1620 is a Mouse Monoclonal Antibody for detection of p53 (wild type) also known as Cellular tumor antigen p53, Tumor suppressor p53 & has been validated in WB & IHC. pricing
MABE518 Anti-phospho-p53 (Thr377), clone EPR5678, Rabbit Monoclonal Antibody 100 µL, This Anti-phospho-p53 (Thr377), clone EPR5678, Rabbit Monoclonal Antibody is validated for use in Western Blotting for the detection of phospho-p53 (Thr377). pricing
25-006 p53 Activating Ligand 500 µg, Peptide corresponding to the cell membrane-translocating sequence linked to the single-stranded DNA binding region of human p53, 'peptide 46', corresponding to amino acids 361-382. pricing
14-865 p53-GST (recombinant protein) 50 µg pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000546 Rosetta Predictions human pricing
NM_001126112 Rosetta Predictions human pricing
NM_001126113 Rosetta Predictions human pricing
NM_001126114 Rosetta Predictions human pricing
NM_001126115 Rosetta Predictions human pricing
NM_001126116 Rosetta Predictions human pricing
NM_001126117 Rosetta Predictions human pricing
NM_030989 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000546 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00302766 predicted 864
2 SASI_Hs02_00302767 predicted 1448
3 SASI_Hs02_00302768 predicted 892
4 SASI_Hs02_00302769 predicted 964
5 SASI_Hs01_00056400 predicted 848
6 SASI_Hs01_00056402 predicted 889
7 SASI_Hs02_00302770 predicted 882
8 SASI_Hs02_00302771 predicted 915
9 SASI_Hs02_00302772 predicted 1465
10 SASI_Hs01_00056395 predicted 1224
11 SASI_Hs01_00056397 predicted 397
12 SASI_Hs01_00056398 predicted 1407
13 SASI_Hs01_00056399 predicted 835
14 SASI_Hs01_00056401 predicted 863
15 SASI_Hs01_00056403 predicted 1033
16 SASI_Hs01_00056404 predicted 425
17 SASI_Hs01_00056396 positive 789
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126112 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00328207 predicted 855
2 SASI_Hs02_00328208 predicted 1441
3 SASI_Hs02_00328209 predicted 885
4 SASI_Hs02_00328210 predicted 961
5 SASI_Hs02_00328211 predicted 785
6 SASI_Hs02_00328212 predicted 850
7 SASI_Hs02_00328213 predicted 884
8 SASI_Hs02_00328214 predicted 878
9 SASI_Hs02_00328215 predicted 912
10 SASI_Hs02_00328216 predicted 1459
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126113 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00328217 predicted 864
2 SASI_Hs02_00328218 predicted 1508
3 SASI_Hs02_00328219 predicted 885
4 SASI_Hs02_00328220 predicted 963
5 SASI_Hs02_00328221 predicted 788
6 SASI_Hs02_00328222 predicted 847
7 SASI_Hs02_00328223 predicted 890
8 SASI_Hs02_00328224 predicted 885
9 SASI_Hs02_00328225 predicted 909
10 SASI_Hs02_00328226 predicted 1526
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126114 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00328227 predicted 857
2 SASI_Hs02_00328228 predicted 1578
3 SASI_Hs02_00328229 predicted 887
4 SASI_Hs02_00328230 predicted 956
5 SASI_Hs02_00328231 predicted 792
6 SASI_Hs02_00328232 predicted 845
7 SASI_Hs02_00328233 predicted 886
8 SASI_Hs02_00328234 predicted 883
9 SASI_Hs02_00328235 predicted 915
10 SASI_Hs02_00328236 predicted 1596
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126115 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00328237 predicted 546
2 SASI_Hs02_00328238 predicted 1135
3 SASI_Hs02_00328239 predicted 570
4 SASI_Hs02_00328240 predicted 649
5 SASI_Hs02_00328241 predicted 468
6 SASI_Hs02_00328242 predicted 529
7 SASI_Hs02_00328243 predicted 576
8 SASI_Hs02_00328244 predicted 562
9 SASI_Hs02_00328245 predicted 595
10 SASI_Hs02_00328246 predicted 1149
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126116 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00328247 predicted 547
2 SASI_Hs02_00328248 predicted 1270
3 SASI_Hs02_00328249 predicted 577
4 SASI_Hs02_00328250 predicted 641
5 SASI_Hs02_00328251 predicted 471
6 SASI_Hs02_00328252 predicted 534
7 SASI_Hs02_00328253 predicted 571
8 SASI_Hs02_00328254 predicted 565
9 SASI_Hs02_00328255 predicted 591
10 SASI_Hs02_00328256 predicted 1286
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126117 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00328257 predicted 545
2 SASI_Hs02_00328258 predicted 1195
3 SASI_Hs02_00328259 predicted 568
4 SASI_Hs02_00328260 predicted 648
5 SASI_Hs02_00328261 predicted 469
6 SASI_Hs02_00328262 predicted 538
7 SASI_Hs02_00328263 predicted 578
8 SASI_Hs02_00328264 predicted 568
9 SASI_Hs02_00328265 predicted 595
10 SASI_Hs02_00328266 predicted 1211
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030989 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00099329 predicted 1153
2 SASI_Rn01_00099330 predicted 498
3 SASI_Rn01_00099331 predicted 240
4 SASI_Rn02_00264152 predicted 504
5 SASI_Rn01_00099333 predicted 275
6 SASI_Rn01_00099334 predicted 812
7 SASI_Rn01_00099336 predicted 604
8 SASI_Rn02_00264153 predicted 240
9 SASI_Rn01_00099338 predicted 483
10 SASI_Rn02_00264154 predicted 1379
11 SASI_Rn01_00099332 positive 1194
12 SASI_Rn01_00099335 predicted 1427
13 SASI_Rn01_00099337 predicted 761
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000546
VALIDATED
TP53 MISSION shRNA Bacterial Glycerol Stock
tumor protein p53
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000003753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000546.x-1095s1c1
Sequence:CCGGCGGCGCACAGAGGAAGAGAATCTCGAGATTCTCTTCCTCTGTGCGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000546.x-427s1c1
Sequence:CCGGGTCCAGATGAAGCTCCCAGAACTCGAGTTCTGGGAGCTTCATCTGGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000546.x-309s1c1
Sequence:CCGGTCAGACCTATGGAAACTACTTCTCGAGAAGTAGTTTCCATAGGTCTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000546.4-887s21c1
Sequence:CCGGCACCATCCACTACAACTACATCTCGAGATGTAGTTGTAGTGGATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000546.4-1041s21c1
Sequence:CCGGCGGCGCACAGAGGAAGAGAATCTCGAGATTCTCTTCCTCTGTGCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000546.4-373s21c1
Sequence:CCGGGTCCAGATGAAGCTCCCAGAACTCGAGTTCTGGGAGCTTCATCTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000546
VALIDATED
TP53 MISSION shRNA shRNA Plasmid DNA
tumor protein p53
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000003753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000546.x-1095s1c1
Sequence:CCGGCGGCGCACAGAGGAAGAGAATCTCGAGATTCTCTTCCTCTGTGCGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000546.x-427s1c1
Sequence:CCGGGTCCAGATGAAGCTCCCAGAACTCGAGTTCTGGGAGCTTCATCTGGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000546.x-309s1c1
Sequence:CCGGTCAGACCTATGGAAACTACTTCTCGAGAAGTAGTTTCCATAGGTCTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000546.4-887s21c1
Sequence:CCGGCACCATCCACTACAACTACATCTCGAGATGTAGTTGTAGTGGATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000546.4-1041s21c1
Sequence:CCGGCGGCGCACAGAGGAAGAGAATCTCGAGATTCTCTTCCTCTGTGCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000546.4-373s21c1
Sequence:CCGGGTCCAGATGAAGCTCCCAGAACTCGAGTTCTGGGAGCTTCATCTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000546
VALIDATED
TP53 MISSION shRNA Lentiviral Transduction Particles
tumor protein p53
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000003753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000546.x-1095s1c1
Sequence:CCGGCGGCGCACAGAGGAAGAGAATCTCGAGATTCTCTTCCTCTGTGCGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000546.x-427s1c1
Sequence:CCGGGTCCAGATGAAGCTCCCAGAACTCGAGTTCTGGGAGCTTCATCTGGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000546.x-309s1c1
Sequence:CCGGTCAGACCTATGGAAACTACTTCTCGAGAAGTAGTTTCCATAGGTCTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000546.4-887s21c1
Sequence:CCGGCACCATCCACTACAACTACATCTCGAGATGTAGTTGTAGTGGATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000546.4-1041s21c1
Sequence:CCGGCGGCGCACAGAGGAAGAGAATCTCGAGATTCTCTTCCTCTGTGCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000546.4-373s21c1
Sequence:CCGGGTCCAGATGAAGCTCCCAGAACTCGAGTTCTGGGAGCTTCATCTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks