EMAIL THIS PAGE TO A FRIEND

TP53AIP1

tumor protein p53 regulated apoptosis inducing protein 1

Synonyms: P53AIP1
Species: Human TP53AIP1(63970)
UniProtKB ID: Q9HCN2, Q6NT40, Q7Z6F7, Q9HCN0, Q9HCN1
Gene ID:
Human(63970) Summary: This gene is specifically expressed in the thymus, and encodes a protein that is localized to the mitochondrion. The expression of this gene is inducible by p53, and it is thought to play an important role in mediating p53-dependent apoptosis. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Oct 2011]
22 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022112 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022112 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022112 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU133591 MISSION® esiRNA esiRNA human TP53AIP1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022112 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022112 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00111108 predicted 497
2 SASI_Hs01_00111109 predicted 349
3 SASI_Hs01_00111111 predicted 537
4 SASI_Hs01_00111112 predicted 530
5 SASI_Hs01_00111113 predicted 317
6 SASI_Hs01_00111114 predicted 833
7 SASI_Hs01_00111115 predicted 311
8 SASI_Hs01_00111116 predicted 809
9 SASI_Hs01_00111117 predicted 297
10 SASI_Hs02_00355505 predicted 812
11 SASI_Hs01_00111110 predicted 535
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022112
TP53AIP1 MISSION shRNA Bacterial Glycerol Stock
tumor protein p53 regulated apoptosis inducing protein 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166464    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022112.1-1351s1c1
Sequence:CCGGCCTCACAGTCTGCTTCCATTTCTCGAGAAATGGAAGCAGACTGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159001    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022112.1-1528s1c1
Sequence:CCGGGCCGTGATAGAATTAAGTGATCTCGAGATCACTTAATTCTATCACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161646    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022112.1-1777s1c1
Sequence:CCGGGCTGGACAATAGGACAGATTTCTCGAGAAATCTGTCCTATTGTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161476    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022112.1-1805s1c1
Sequence:CCGGGCAGTCTTCCATTCCAACTTTCTCGAGAAAGTTGGAATGGAAGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161849    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022112.1-1117s1c1
Sequence:CCGGGCCGGTTTATGTCTGTTCTTTCTCGAGAAAGAACAGACATAAACCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165272    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022112.1-660s1c1
Sequence:CCGGGCATCCAGAAAGTGAGAGCTACTCGAGTAGCTCTCACTTTCTGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165785    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022112.1-1569s1c1
Sequence:CCGGCCAGGTAACGACATAGGGTTTCTCGAGAAACCCTATGTCGTTACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022112
TP53AIP1 MISSION shRNA shRNA Plasmid DNA
tumor protein p53 regulated apoptosis inducing protein 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166464    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022112.1-1351s1c1
Sequence:CCGGCCTCACAGTCTGCTTCCATTTCTCGAGAAATGGAAGCAGACTGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159001    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022112.1-1528s1c1
Sequence:CCGGGCCGTGATAGAATTAAGTGATCTCGAGATCACTTAATTCTATCACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161646    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022112.1-1777s1c1
Sequence:CCGGGCTGGACAATAGGACAGATTTCTCGAGAAATCTGTCCTATTGTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161476    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022112.1-1805s1c1
Sequence:CCGGGCAGTCTTCCATTCCAACTTTCTCGAGAAAGTTGGAATGGAAGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161849    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022112.1-1117s1c1
Sequence:CCGGGCCGGTTTATGTCTGTTCTTTCTCGAGAAAGAACAGACATAAACCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165272    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022112.1-660s1c1
Sequence:CCGGGCATCCAGAAAGTGAGAGCTACTCGAGTAGCTCTCACTTTCTGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165785    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022112.1-1569s1c1
Sequence:CCGGCCAGGTAACGACATAGGGTTTCTCGAGAAACCCTATGTCGTTACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022112
TP53AIP1 MISSION shRNA Lentiviral Transduction Particles
tumor protein p53 regulated apoptosis inducing protein 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166464    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022112.1-1351s1c1
Sequence:CCGGCCTCACAGTCTGCTTCCATTTCTCGAGAAATGGAAGCAGACTGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159001    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022112.1-1528s1c1
Sequence:CCGGGCCGTGATAGAATTAAGTGATCTCGAGATCACTTAATTCTATCACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161646    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022112.1-1777s1c1
Sequence:CCGGGCTGGACAATAGGACAGATTTCTCGAGAAATCTGTCCTATTGTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161476    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022112.1-1805s1c1
Sequence:CCGGGCAGTCTTCCATTCCAACTTTCTCGAGAAAGTTGGAATGGAAGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161849    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022112.1-1117s1c1
Sequence:CCGGGCCGGTTTATGTCTGTTCTTTCTCGAGAAAGAACAGACATAAACCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165272    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022112.1-660s1c1
Sequence:CCGGGCATCCAGAAAGTGAGAGCTACTCGAGTAGCTCTCACTTTCTGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165785    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022112.1-1569s1c1
Sequence:CCGGCCAGGTAACGACATAGGGTTTCTCGAGAAACCCTATGTCGTTACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks