EMAIL THIS PAGE TO A FRIEND

TP53BP1

tumor protein p53 binding protein 1

Synonyms: 53BP1 p202
UniProtKB ID: Q12888, Q2M1Z7, Q4LE46, Q5FWZ3, Q7Z3U4
Gene ID:
Rat(296099) tumor protein p53 binding protein 1
Zebrafish(324972) tumor protein p53 binding protein, 1
Horse(100056322) tumor protein p53 binding protein 1
domestic cat(101098873) tumor protein p53 binding protein 1
dog(478274) tumor protein p53 binding protein 1
chicken(415589) tumor protein p53 binding protein 1
naked mole-rat(101721077) tumor protein p53 binding protein 1
Domestic Rabbit(100328680) tumor protein p53 binding protein 1
domestic guinea pig(100717584) tumor protein p53 binding protein 1
cow(509111) tumor protein p53 binding protein 1
sheep(101107637) tumor protein p53 binding protein 1
57 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
B4436 Anti-53BP1 (C-terminal) antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous solution human, mouse (predicted), rat (predicted)
immunoprecipitation, microarray, western blot pricing
B4561 Anti-53BP1 (N-terminal) antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous solution human, mouse (predicted), rat (predicted)
immunoprecipitation, microarray, western blot pricing
SAB4503016 Anti-53BP1, N-Terminal antibody produced in rabbit affinity isolated antibody human, mouse, rat
immunofluorescence, western blot pricing
SAB4503017 Anti-53BP1, N-Terminal antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, western blot pricing
SAB4504071 Anti-phospho-53BP1 (pSer6) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry, western blot pricing
HPA008788 Anti-TP53BP1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
HPA022133 Anti-TP53BP1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution mouse, rat, human
immunofluorescence, immunohistochemistry, western blot pricing
PLA0303 Goat anti-53BP1 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. human
immunoprecipitation, proximity ligation assay pricing
WH0007158M1 Monoclonal Anti-TP53BP1 antibody produced in mouse clone 1B9, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
PLA0077 Rabbit anti-53BP1 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. mouse, gorilla, human, rabbit, chimpanzee, dog, bovine, primate, rhesus monkey, marmoset, horse, Chinese hamster
proximity ligation assay, western blot pricing
PLA0126 Rabbit anti-Phospho 53BP1 (S25) Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. dog, primate, gorilla, rabbit, mouse, chimpanzee, pig, bovine, guinea pig, human, horse, rhesus monkey
immunofluorescence, immunohistochemistry, immunoprecipitation, proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005657 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005657 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005657 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU156121 MISSION® esiRNA esiRNA human TP53BP1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005657 Rosetta Predictions human pricing
NM_001106501 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005657 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00024577 predicted 1238
2 SASI_Hs01_00024578 predicted 2904
3 SASI_Hs02_00340025 predicted 4726
4 SASI_Hs01_00024579 predicted 1795
5 SASI_Hs02_00340026 predicted 2976
6 SASI_Hs01_00024580 predicted 2986
7 SASI_Hs01_00024581 predicted 1595
8 SASI_Hs01_00024585 predicted 2594
9 SASI_Hs01_00024586 predicted 307
10 SASI_Hs02_00340027 predicted 3343
11 SASI_Hs01_00024582 predicted 5568
12 SASI_Hs01_00024583 predicted 4748
13 SASI_Hs01_00024584 predicted 1593
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106501 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00219588 predicted 4317
2 SASI_Rn02_00219589 predicted 2779
3 SASI_Rn02_00219590 predicted 2249
4 SASI_Rn02_00219591 predicted 3279
5 SASI_Rn02_00219592 predicted 3227
6 SASI_Rn02_00219593 predicted 4234
7 SASI_Rn02_00219594 predicted 2269
8 SASI_Rn02_00219595 predicted 3076
9 SASI_Rn02_00219596 predicted 3639
10 SASI_Rn02_00219597 predicted 4269
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005657
VALIDATED
TP53BP1 MISSION shRNA Bacterial Glycerol Stock
tumor protein p53 binding protein 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000018865    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005657.1-6094s1c1
Sequence:CCGGGATACTTGGTCTTACTGGTTTCTCGAGAAACCAGTAAGACCAAGTATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005657.1-2332s1c1
Sequence:CCGGCCAGTGTGATTAGTATTGATTCTCGAGAATCAATACTAATCACACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005657.1-5340s1c1
Sequence:CCGGCCTCTCAACAAGACCTTGTTTCTCGAGAAACAAGGTCTTGTTGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005657.1-5893s1c1
Sequence:CCGGCCCATAACAAAGATATTGCTTCTCGAGAAGCAATATCTTTGTTATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005657.1-1219s1c1
Sequence:CCGGCCCTTGTTCAGGACAGTCTTTCTCGAGAAAGACTGTCCTGAACAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005657.1-386s21c1
Sequence:CCGGAGAACGAGGAGACGGTAATAGCTCGAGCTATTACCGTCTCCTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005657.1-2981s21c1
Sequence:CCGGCAGTACTCCTATTGGTATTAGCTCGAGCTAATACCAATAGGAGTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005657.1-219s21c1
Sequence:GTACCGGGATACTCCTTGCCTGATAATTCTCGAGAATTATCAGGCAAGGAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005657.1-804s21c1
Sequence:GTACCGGGATGCTAATACTGCAATTAAGCTCGAGCTTAATTGCAGTATTAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229640    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005657.1-6094s21c1
Sequence:CCGGGATACTTGGTCTTACTGGTTTCTCGAGAAACCAGTAAGACCAAGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005657
VALIDATED
TP53BP1 MISSION shRNA shRNA Plasmid DNA
tumor protein p53 binding protein 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000018865    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005657.1-6094s1c1
Sequence:CCGGGATACTTGGTCTTACTGGTTTCTCGAGAAACCAGTAAGACCAAGTATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005657.1-2332s1c1
Sequence:CCGGCCAGTGTGATTAGTATTGATTCTCGAGAATCAATACTAATCACACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005657.1-5340s1c1
Sequence:CCGGCCTCTCAACAAGACCTTGTTTCTCGAGAAACAAGGTCTTGTTGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005657.1-5893s1c1
Sequence:CCGGCCCATAACAAAGATATTGCTTCTCGAGAAGCAATATCTTTGTTATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005657.1-1219s1c1
Sequence:CCGGCCCTTGTTCAGGACAGTCTTTCTCGAGAAAGACTGTCCTGAACAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005657.1-386s21c1
Sequence:CCGGAGAACGAGGAGACGGTAATAGCTCGAGCTATTACCGTCTCCTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005657.1-2981s21c1
Sequence:CCGGCAGTACTCCTATTGGTATTAGCTCGAGCTAATACCAATAGGAGTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005657.1-219s21c1
Sequence:GTACCGGGATACTCCTTGCCTGATAATTCTCGAGAATTATCAGGCAAGGAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005657.1-804s21c1
Sequence:GTACCGGGATGCTAATACTGCAATTAAGCTCGAGCTTAATTGCAGTATTAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229640    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005657.1-6094s21c1
Sequence:CCGGGATACTTGGTCTTACTGGTTTCTCGAGAAACCAGTAAGACCAAGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005657
VALIDATED
TP53BP1 MISSION shRNA Lentiviral Transduction Particles
tumor protein p53 binding protein 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000018865    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005657.1-6094s1c1
Sequence:CCGGGATACTTGGTCTTACTGGTTTCTCGAGAAACCAGTAAGACCAAGTATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005657.1-2332s1c1
Sequence:CCGGCCAGTGTGATTAGTATTGATTCTCGAGAATCAATACTAATCACACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005657.1-5340s1c1
Sequence:CCGGCCTCTCAACAAGACCTTGTTTCTCGAGAAACAAGGTCTTGTTGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005657.1-5893s1c1
Sequence:CCGGCCCATAACAAAGATATTGCTTCTCGAGAAGCAATATCTTTGTTATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005657.1-1219s1c1
Sequence:CCGGCCCTTGTTCAGGACAGTCTTTCTCGAGAAAGACTGTCCTGAACAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005657.1-386s21c1
Sequence:CCGGAGAACGAGGAGACGGTAATAGCTCGAGCTATTACCGTCTCCTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005657.1-2981s21c1
Sequence:CCGGCAGTACTCCTATTGGTATTAGCTCGAGCTAATACCAATAGGAGTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005657.1-219s21c1
Sequence:GTACCGGGATACTCCTTGCCTGATAATTCTCGAGAATTATCAGGCAAGGAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005657.1-804s21c1
Sequence:GTACCGGGATGCTAATACTGCAATTAAGCTCGAGCTTAATTGCAGTATTAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229640    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005657.1-6094s21c1
Sequence:CCGGGATACTTGGTCTTACTGGTTTCTCGAGAAACCAGTAAGACCAAGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks