EMAIL THIS PAGE TO A FRIEND

TP53BP2

tumor protein p53 binding protein, 2

Synonyms: 53BP2 ASPP2 BBP P53BP2 PPP1R13A
UniProtKB ID: Q13625, B4DG66, Q12892, Q86X75, Q96KQ3
Gene ID:
Human(7159) Summary: This gene encodes a member of the ASPP (apoptosis-stimulating protein of p53) family of p53 interacting proteins. The protein contains four ankyrin repeats and an SH3 domain involved in protein-protein interactions. It is localized to the perinuclear region of the cytoplasm, and regulates apoptosis and cell growth through interactions with other regulatory molecules including members of the p53 family. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Rat(305025) tumor protein p53 binding protein, 2
cow(514474) tumor protein p53 binding protein, 2
sheep(101108587) tumor protein p53 binding protein, 2
domestic guinea pig(100732221) tumor protein p53 binding protein, 2
Domestic Rabbit(100349267) tumor protein p53 binding protein, 2
naked mole-rat(101720764) tumor protein p53 binding protein, 2
Zebrafish(407983) tumor protein p53 binding protein, 2
chicken(421329) tumor protein p53 binding protein, 2
dog(490397) tumor protein p53 binding protein, 2
Horse(100055278) tumor protein p53 binding protein, 2
92 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005426 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005426 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005426 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU070471 MISSION® esiRNA esiRNA human TP53BP2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001031685 Rosetta Predictions human pricing
NM_005426 Rosetta Predictions human pricing
XM_001063503 Rosetta Predictions rat pricing
XM_223012 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031685 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00046451 predicted 1980
2 SASI_Hs02_00307689 predicted 1538
3 SASI_Hs02_00307690 predicted 3089
4 SASI_Hs01_00046452 predicted 885
5 SASI_Hs02_00307691 predicted 1352
6 SASI_Hs02_00307692 predicted 1202
7 SASI_Hs02_00307693 predicted 2081
8 SASI_Hs02_00307694 predicted 3116
9 SASI_Hs02_00307695 predicted 1216
10 SASI_Hs01_00046455 predicted 3795
11 SASI_Hs01_00046448 predicted 2201
12 SASI_Hs01_00046449 predicted 1568
13 SASI_Hs01_00046450 predicted 2834
14 SASI_Hs01_00046453 predicted 2458
15 SASI_Hs01_00046454 predicted 2319
16 SASI_Hs01_00046456 predicted 3582
17 SASI_Hs01_00046457 predicted 2565
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005426 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00077611 predicted 2107
2 SASI_Hs02_00339565 predicted 1669
3 SASI_Hs02_00339566 predicted 3220
4 SASI_Hs01_00077612 predicted 1019
5 SASI_Hs02_00339567 predicted 1480
6 SASI_Hs02_00339568 predicted 1330
7 SASI_Hs02_00339569 predicted 2217
8 SASI_Hs02_00339570 predicted 3248
9 SASI_Hs02_00339571 predicted 1350
10 SASI_Hs01_00077615 predicted 3922
11 SASI_Hs01_00077608 predicted 2313
12 SASI_Hs01_00077609 predicted 1693
13 SASI_Hs01_00077610 predicted 2956
14 SASI_Hs01_00077613 predicted 2583
15 SASI_Hs01_00077614 predicted 2439
16 SASI_Hs01_00077616 predicted 3708
17 SASI_Hs01_00077617 predicted 2685
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063503 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00307356 predicted 2526
2 SASI_Rn02_00307357 predicted 220
3 SASI_Rn02_00307358 predicted 297
4 SASI_Rn02_00307359 predicted 2491
5 SASI_Rn02_00307360 predicted 2153
6 SASI_Rn02_00307361 predicted 2183
7 SASI_Rn02_00307362 predicted 891
8 SASI_Rn02_00307363 predicted 451
9 SASI_Rn02_00307364 predicted 2763
10 SASI_Rn02_00307365 predicted 431
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_223012 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00381054 predicted 2611
2 SASI_Rn02_00381055 predicted 278
3 SASI_Rn02_00381056 predicted 357
4 SASI_Rn02_00381057 predicted 2582
5 SASI_Rn02_00381058 predicted 2236
6 SASI_Rn02_00381059 predicted 2267
7 SASI_Rn02_00381060 predicted 956
8 SASI_Rn02_00381061 predicted 510
9 SASI_Rn02_00381062 predicted 2849
10 SASI_Rn02_00381063 predicted 498
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005426
VALIDATED
TP53BP2 MISSION shRNA Bacterial Glycerol Stock
tumor protein p53 binding protein, 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000370371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005426.2-1308s21c1
Sequence:CCGGAGTGTTTGAATAAGCGTAATTCTCGAGAATTACGCTTATTCAAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005426.2-3592s21c1
Sequence:CCGGTCAGGAGAAGATGGGCATAATCTCGAGATTATGCCCATCTTCTCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005426.2-1226s21c1
Sequence:CCGGGAGCTTGATCGCCTCTATAAGCTCGAGCTTATAGAGGCGATCAAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005426.2-2798s21c1
Sequence:CCGGGAAATCCAGAATCCATATTTACTCGAGTAAATATGGATTCTGGATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005426.2-893s21c1
Sequence:CCGGACTAAGGAACAGCGCTTAAAGCTCGAGCTTTAAGCGCTGTTCCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303474    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005426.2-4121s21c1
Sequence:CCGGGTCTAGTAAATAGGATCATTTCTCGAGAAATGATCCTATTTACTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005426.2-1337s21c1
Sequence:CCGGGCAGTCATGGATAAGCGTGTTCTCGAGAACACGCTTATCCATGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005426.1-2481s1c1
Sequence:CCGGCCCAACTAAATTACTGCCTTTCTCGAGAAAGGCAGTAATTTAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005426.1-3690s1c1
Sequence:CCGGCCTTAATGATAAGGAGGGATACTCGAGTATCCCTCCTTATCATTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005426.1-1282s1c1
Sequence:CCGGGCAGTCATGGATAAGCGTGTTCTCGAGAACACGCTTATCCATGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005426
VALIDATED
TP53BP2 MISSION shRNA shRNA Plasmid DNA
tumor protein p53 binding protein, 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000370371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005426.2-1308s21c1
Sequence:CCGGAGTGTTTGAATAAGCGTAATTCTCGAGAATTACGCTTATTCAAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005426.2-3592s21c1
Sequence:CCGGTCAGGAGAAGATGGGCATAATCTCGAGATTATGCCCATCTTCTCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005426.2-1226s21c1
Sequence:CCGGGAGCTTGATCGCCTCTATAAGCTCGAGCTTATAGAGGCGATCAAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005426.2-2798s21c1
Sequence:CCGGGAAATCCAGAATCCATATTTACTCGAGTAAATATGGATTCTGGATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005426.2-893s21c1
Sequence:CCGGACTAAGGAACAGCGCTTAAAGCTCGAGCTTTAAGCGCTGTTCCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303474    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005426.2-4121s21c1
Sequence:CCGGGTCTAGTAAATAGGATCATTTCTCGAGAAATGATCCTATTTACTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005426.2-1337s21c1
Sequence:CCGGGCAGTCATGGATAAGCGTGTTCTCGAGAACACGCTTATCCATGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005426.1-2481s1c1
Sequence:CCGGCCCAACTAAATTACTGCCTTTCTCGAGAAAGGCAGTAATTTAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005426.1-3690s1c1
Sequence:CCGGCCTTAATGATAAGGAGGGATACTCGAGTATCCCTCCTTATCATTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005426.1-1282s1c1
Sequence:CCGGGCAGTCATGGATAAGCGTGTTCTCGAGAACACGCTTATCCATGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005426
VALIDATED
TP53BP2 MISSION shRNA Lentiviral Transduction Particles
tumor protein p53 binding protein, 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000370371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005426.2-1308s21c1
Sequence:CCGGAGTGTTTGAATAAGCGTAATTCTCGAGAATTACGCTTATTCAAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005426.2-3592s21c1
Sequence:CCGGTCAGGAGAAGATGGGCATAATCTCGAGATTATGCCCATCTTCTCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005426.2-1226s21c1
Sequence:CCGGGAGCTTGATCGCCTCTATAAGCTCGAGCTTATAGAGGCGATCAAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005426.2-2798s21c1
Sequence:CCGGGAAATCCAGAATCCATATTTACTCGAGTAAATATGGATTCTGGATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005426.2-893s21c1
Sequence:CCGGACTAAGGAACAGCGCTTAAAGCTCGAGCTTTAAGCGCTGTTCCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303474    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005426.2-4121s21c1
Sequence:CCGGGTCTAGTAAATAGGATCATTTCTCGAGAAATGATCCTATTTACTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005426.2-1337s21c1
Sequence:CCGGGCAGTCATGGATAAGCGTGTTCTCGAGAACACGCTTATCCATGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005426.1-2481s1c1
Sequence:CCGGCCCAACTAAATTACTGCCTTTCTCGAGAAAGGCAGTAATTTAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005426.1-3690s1c1
Sequence:CCGGCCTTAATGATAAGGAGGGATACTCGAGTATCCCTCCTTATCATTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005426.1-1282s1c1
Sequence:CCGGGCAGTCATGGATAAGCGTGTTCTCGAGAACACGCTTATCCATGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks