EMAIL THIS PAGE TO A FRIEND

TP53I11

tumor protein p53 inducible protein 11

Synonyms: PIG11
UniProtKB ID: O14683, Q3ZCS0
Gene ID:
Rat(311209) tumor protein p53 inducible protein 11
chicken(426399) tumor protein p53 inducible protein 11
domestic cat(101084824) tumor protein p53 inducible protein 11
dog(483645) tumor protein p53 inducible protein 11
naked mole-rat(101712052) tumor protein p53 inducible protein 11
domestic guinea pig(100721312) tumor protein p53 inducible protein 11
cow(515682) tumor protein p53 inducible protein 11
sheep(101111656) tumor protein p53 inducible protein 11
57 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006034 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006034 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006034 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU099101 MISSION® esiRNA esiRNA human TP53I11 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001076787 Rosetta Predictions human pricing
NM_006034 Rosetta Predictions human pricing
NM_001107749 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001076787 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00312064 predicted 792
2 SASI_Hs02_00312065 predicted 958
3 SASI_Hs02_00312066 predicted 1026
4 SASI_Hs02_00312067 predicted 1396
5 SASI_Hs02_00312068 predicted 759
6 SASI_Hs02_00312069 predicted 892
7 SASI_Hs02_00312070 predicted 931
8 SASI_Hs02_00312071 predicted 1272
9 SASI_Hs02_00312072 predicted 781
10 SASI_Hs02_00312073 predicted 911
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006034 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00174967 predicted 663
2 SASI_Hs01_00174968 predicted 833
3 SASI_Hs01_00174970 predicted 901
4 SASI_Hs01_00174971 predicted 1266
5 SASI_Hs01_00174972 predicted 628
6 SASI_Hs01_00174973 predicted 766
7 SASI_Hs01_00174974 predicted 799
8 SASI_Hs02_00340767 predicted 1141
9 SASI_Hs02_00340768 predicted 648
10 SASI_Hs02_00340769 predicted 776
11 SASI_Hs01_00174966 predicted 747
12 SASI_Hs01_00174969 predicted 345
13 SASI_Hs01_00174975 predicted 980
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107749 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00231885 predicted 433
2 SASI_Rn02_00231886 predicted 759
3 SASI_Rn02_00231887 predicted 542
4 SASI_Rn02_00231888 predicted 342
5 SASI_Rn02_00231889 predicted 663
6 SASI_Rn02_00231890 predicted 361
7 SASI_Rn02_00231891 predicted 950
8 SASI_Rn02_00231892 predicted 971
9 SASI_Rn02_00231893 predicted 286
10 SASI_Rn02_00231894 predicted 563
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006034
VALIDATED
TP53I11 MISSION shRNA Bacterial Glycerol Stock
tumor protein p53 inducible protein 11
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143672    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_006034.2-1253s1c1
Sequence:CCGGGCTAAACTTGGCTTCCTTCTACTCGAGTAGAAGGAAGCCAAGTTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_006034.2-603s1c1
Sequence:CCGGGCTGAGAAGGTCATCATTCGACTCGAGTCGAATGATGACCTTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_006034.2-632s1c1
Sequence:CCGGGCTCACCGAAGCTTGCTATTTCTCGAGAAATAGCAAGCTTCGGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_006034.2-578s1c1
Sequence:CCGGGATCATGTGGAACGCTCTCTACTCGAGTAGAGAGCGTTCCACATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140750    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006034.2-1250s1c1
Sequence:CCGGGCAGCTAAACTTGGCTTCCTTCTCGAGAAGGAAGCCAAGTTTAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006034.2-392s1c1
Sequence:CCGGGTTTACCATTCGGGAGCCTTTCTCGAGAAAGGCTCCCGAATGGTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139326    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006034.2-1045s1c1
Sequence:CCGGCCTCACAGTGATACCTCCTTTCTCGAGAAAGGAGGTATCACTGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139494    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_006034.2-1246s1c1
Sequence:CCGGCCAAGCAGCTAAACTTGGCTTCTCGAGAAGCCAAGTTTAGCTGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006034.2-441s1c1
Sequence:CCGGGCTGTGCTCTTCTCCGGCATTCTCGAGAATGCCGGAGAAGAGCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006034.2-749s1c1
Sequence:CCGGCGTCATCAGCATTTACTACTACTCGAGTAGTAGTAAATGCTGATGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006034
VALIDATED
TP53I11 MISSION shRNA shRNA Plasmid DNA
tumor protein p53 inducible protein 11
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143672    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_006034.2-1253s1c1
Sequence:CCGGGCTAAACTTGGCTTCCTTCTACTCGAGTAGAAGGAAGCCAAGTTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_006034.2-603s1c1
Sequence:CCGGGCTGAGAAGGTCATCATTCGACTCGAGTCGAATGATGACCTTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_006034.2-632s1c1
Sequence:CCGGGCTCACCGAAGCTTGCTATTTCTCGAGAAATAGCAAGCTTCGGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_006034.2-578s1c1
Sequence:CCGGGATCATGTGGAACGCTCTCTACTCGAGTAGAGAGCGTTCCACATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140750    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006034.2-1250s1c1
Sequence:CCGGGCAGCTAAACTTGGCTTCCTTCTCGAGAAGGAAGCCAAGTTTAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006034.2-392s1c1
Sequence:CCGGGTTTACCATTCGGGAGCCTTTCTCGAGAAAGGCTCCCGAATGGTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139326    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006034.2-1045s1c1
Sequence:CCGGCCTCACAGTGATACCTCCTTTCTCGAGAAAGGAGGTATCACTGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139494    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_006034.2-1246s1c1
Sequence:CCGGCCAAGCAGCTAAACTTGGCTTCTCGAGAAGCCAAGTTTAGCTGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006034.2-441s1c1
Sequence:CCGGGCTGTGCTCTTCTCCGGCATTCTCGAGAATGCCGGAGAAGAGCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006034.2-749s1c1
Sequence:CCGGCGTCATCAGCATTTACTACTACTCGAGTAGTAGTAAATGCTGATGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006034
VALIDATED
TP53I11 MISSION shRNA Lentiviral Transduction Particles
tumor protein p53 inducible protein 11
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143672    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_006034.2-1253s1c1
Sequence:CCGGGCTAAACTTGGCTTCCTTCTACTCGAGTAGAAGGAAGCCAAGTTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_006034.2-603s1c1
Sequence:CCGGGCTGAGAAGGTCATCATTCGACTCGAGTCGAATGATGACCTTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_006034.2-632s1c1
Sequence:CCGGGCTCACCGAAGCTTGCTATTTCTCGAGAAATAGCAAGCTTCGGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_006034.2-578s1c1
Sequence:CCGGGATCATGTGGAACGCTCTCTACTCGAGTAGAGAGCGTTCCACATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140750    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006034.2-1250s1c1
Sequence:CCGGGCAGCTAAACTTGGCTTCCTTCTCGAGAAGGAAGCCAAGTTTAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006034.2-392s1c1
Sequence:CCGGGTTTACCATTCGGGAGCCTTTCTCGAGAAAGGCTCCCGAATGGTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139326    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006034.2-1045s1c1
Sequence:CCGGCCTCACAGTGATACCTCCTTTCTCGAGAAAGGAGGTATCACTGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139494    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_006034.2-1246s1c1
Sequence:CCGGCCAAGCAGCTAAACTTGGCTTCTCGAGAAGCCAAGTTTAGCTGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006034.2-441s1c1
Sequence:CCGGGCTGTGCTCTTCTCCGGCATTCTCGAGAATGCCGGAGAAGAGCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006034.2-749s1c1
Sequence:CCGGCGTCATCAGCATTTACTACTACTCGAGTAGTAGTAAATGCTGATGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks