EMAIL THIS PAGE TO A FRIEND

TP53I13

tumor protein p53 inducible protein 13

Synonyms: DSCP1
UniProtKB ID: Q8NBR0, Q7L5U3
Gene ID:
Rat(287550) tumor protein p53 inducible protein 13
dog(611028) tumor protein p53 inducible protein 13
domestic cat(101092468) tumor protein p53 inducible protein 13
cow(513556) tumor protein p53 inducible protein 13
sheep(101110154) tumor protein p53 inducible protein 13
domestic guinea pig(100719505) tumor protein p53 inducible protein 13
naked mole-rat(101699152) tumor protein p53 inducible protein 13
31 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV51702 Anti-TP53I13 antibody produced in rabbit affinity isolated antibody guinea pig, horse, rat, bovine, canine, mouse, rabbit, human
western blot pricing
SAB2103419 Anti-TP53I13 antibody produced in rabbit affinity isolated antibody human, rat, guinea pig, bovine, rabbit, mouse, horse
western blot pricing
HPA043963 Anti-TP53I13 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138349 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138349 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138349 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138349 Rosetta Predictions human pricing
NM_001105818 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138349 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00179925 predicted 290
2 SASI_Hs01_00179926 predicted 623
3 SASI_Hs01_00179927 predicted 287
4 SASI_Hs01_00179928 predicted 1021
5 SASI_Hs01_00179929 predicted 288
6 SASI_Hs01_00179930 predicted 872
7 SASI_Hs02_00363442 predicted 971
8 SASI_Hs01_00179931 predicted 457
9 SASI_Hs01_00179932 predicted 459
10 SASI_Hs01_00179933 predicted 716
11 SASI_Hs01_00179934 predicted 1147
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105818 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00212836 predicted 211
2 SASI_Rn02_00212837 predicted 307
3 SASI_Rn02_00212838 predicted 484
4 SASI_Rn02_00212839 predicted 217
5 SASI_Rn02_00212840 predicted 234
6 SASI_Rn02_00212841 predicted 199
7 SASI_Rn02_00212842 predicted 307
8 SASI_Rn02_00212843 predicted 247
9 SASI_Rn02_00212844 predicted 845
10 SASI_Rn02_00212845 predicted 198
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138349
TP53I13 MISSION shRNA Bacterial Glycerol Stock
tumor protein p53 inducible protein 13
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000179376    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138349.2-452s1c1
Sequence:CCGGGAAGAAGAAGGCATGGATCTACTCGAGTAGATCCATGCCTTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179207    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138349.2-467s1c1
Sequence:CCGGGATCTACTGTGAAAGCCTTTCCTCGAGGAAAGGCTTTCACAGTAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138349
TP53I13 MISSION shRNA shRNA Plasmid DNA
tumor protein p53 inducible protein 13
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000179376    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138349.2-452s1c1
Sequence:CCGGGAAGAAGAAGGCATGGATCTACTCGAGTAGATCCATGCCTTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179207    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138349.2-467s1c1
Sequence:CCGGGATCTACTGTGAAAGCCTTTCCTCGAGGAAAGGCTTTCACAGTAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138349
TP53I13 MISSION shRNA Lentiviral Transduction Particles
tumor protein p53 inducible protein 13
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000179376    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138349.2-452s1c1
Sequence:CCGGGAAGAAGAAGGCATGGATCTACTCGAGTAGATCCATGCCTTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179207    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138349.2-467s1c1
Sequence:CCGGGATCTACTGTGAAAGCCTTTCCTCGAGGAAAGGCTTTCACAGTAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks