EMAIL THIS PAGE TO A FRIEND

TP53I3

tumor protein p53 inducible protein 3

Synonyms: PIG3
Gene ID:
Human(9540) Summary: The protein encoded by this gene is similar to oxidoreductases, which are enzymes involved in cellular responses to oxidative stresses and irradiation. This gene is induced by the tumor suppressor p53 and is thought to be involved in p53-mediated cell death. It contains a p53 consensus binding site in its promoter region and a downstream pentanucleotide microsatellite sequence. P53 has been shown to transcriptionally activate this gene by interacting with the downstream pentanucleotide microsatellite sequence. The microsatellite is polymorphic, with a varying number of pentanucleotide repeats directly correlated with the extent of transcriptional activation by p53. It has been suggested that the microsatellite polymorphism may be associated with differential susceptibility to cancer. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2011]
naked mole-rat(101725853) tumor protein p53 inducible protein 3
domestic guinea pig(100718690) tumor protein p53 inducible protein 3
cow(508875) tumor protein p53 inducible protein 3
sheep(101106244) tumor protein p53 inducible protein 3
chicken(421977) tumor protein p53 inducible protein 3
domestic cat(101095649) tumor protein p53 inducible protein 3
dog(610825) tumor protein p53 inducible protein 3
42 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004881 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004881 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004881 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU059861 MISSION® esiRNA esiRNA human TP53I3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004881 Rosetta Predictions human pricing
NM_147184 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004881 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00025204 predicted 1329
2 SASI_Hs01_00025205 predicted 1329
3 SASI_Hs01_00025206 predicted 1137
4 SASI_Hs01_00025207 predicted 918
5 SASI_Hs01_00025208 predicted 1106
6 SASI_Hs01_00025209 predicted 1376
7 SASI_Hs01_00025210 predicted 962
8 SASI_Hs01_00025211 predicted 1427
9 SASI_Hs01_00025212 predicted 1202
10 SASI_Hs01_00025213 predicted 1299
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_147184 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00191476 predicted 858
2 SASI_Hs01_00191477 predicted 863
3 SASI_Hs01_00191478 predicted 668
4 SASI_Hs01_00191479 predicted 442
5 SASI_Hs01_00191480 predicted 634
6 SASI_Hs01_00191481 predicted 900
7 SASI_Hs01_00191482 predicted 489
8 SASI_Hs01_00191483 predicted 948
9 SASI_Hs01_00191484 predicted 734
10 SASI_Hs01_00191485 predicted 827
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004881
VALIDATED
TP53I3 MISSION shRNA Bacterial Glycerol Stock
tumor protein p53 inducible protein 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000157726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_004881.2-932s1c1
Sequence:CCGGCTTGTGGGAAATGTTCAGGCTCTCGAGAGCCTGAACATTTCCCACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_004881.2-1327s1c1
Sequence:CCGGGCTGAGGTCTAGGGACAATAACTCGAGTTATTGTCCCTAGACCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_004881.2-1364s1c1
Sequence:CCGGGTGAATGCTTTCACGGAGCAACTCGAGTTGCTCCGTGAAAGCATTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_004881.2-1477s1c1
Sequence:CCGGGTACATGGAGGCCAACAAGAACTCGAGTTCTTGTTGGCCTCCATGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_004881.2-1123s1c1
Sequence:CCGGCTCTGAAGCAACGCTGAAATTCTCGAGAATTTCAGCGTTGCTTCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155522    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004881.2-1130s1c1
Sequence:CCGGGCAACGCTGAAATTCACCAAACTCGAGTTTGGTGAATTTCAGCGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155268    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004881.2-1366s1c1
Sequence:CCGGGAATGCTTTCACGGAGCAAATCTCGAGATTTGCTCCGTGAAAGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004881.2-1151s21c1
Sequence:CCGGGGTGCTGGAGTTAATCTTATTCTCGAGAATAAGATTAACTCCAGCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004881.2-1086s21c1
Sequence:CCGGGAGCAGCTGCTGGATTCAATTCTCGAGAATTGAATCCAGCAGCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004881
VALIDATED
TP53I3 MISSION shRNA shRNA Plasmid DNA
tumor protein p53 inducible protein 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000157726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_004881.2-932s1c1
Sequence:CCGGCTTGTGGGAAATGTTCAGGCTCTCGAGAGCCTGAACATTTCCCACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_004881.2-1327s1c1
Sequence:CCGGGCTGAGGTCTAGGGACAATAACTCGAGTTATTGTCCCTAGACCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_004881.2-1364s1c1
Sequence:CCGGGTGAATGCTTTCACGGAGCAACTCGAGTTGCTCCGTGAAAGCATTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_004881.2-1477s1c1
Sequence:CCGGGTACATGGAGGCCAACAAGAACTCGAGTTCTTGTTGGCCTCCATGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_004881.2-1123s1c1
Sequence:CCGGCTCTGAAGCAACGCTGAAATTCTCGAGAATTTCAGCGTTGCTTCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155522    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004881.2-1130s1c1
Sequence:CCGGGCAACGCTGAAATTCACCAAACTCGAGTTTGGTGAATTTCAGCGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155268    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004881.2-1366s1c1
Sequence:CCGGGAATGCTTTCACGGAGCAAATCTCGAGATTTGCTCCGTGAAAGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004881.2-1151s21c1
Sequence:CCGGGGTGCTGGAGTTAATCTTATTCTCGAGAATAAGATTAACTCCAGCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004881.2-1086s21c1
Sequence:CCGGGAGCAGCTGCTGGATTCAATTCTCGAGAATTGAATCCAGCAGCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004881
VALIDATED
TP53I3 MISSION shRNA Lentiviral Transduction Particles
tumor protein p53 inducible protein 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000157726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_004881.2-932s1c1
Sequence:CCGGCTTGTGGGAAATGTTCAGGCTCTCGAGAGCCTGAACATTTCCCACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_004881.2-1327s1c1
Sequence:CCGGGCTGAGGTCTAGGGACAATAACTCGAGTTATTGTCCCTAGACCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_004881.2-1364s1c1
Sequence:CCGGGTGAATGCTTTCACGGAGCAACTCGAGTTGCTCCGTGAAAGCATTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_004881.2-1477s1c1
Sequence:CCGGGTACATGGAGGCCAACAAGAACTCGAGTTCTTGTTGGCCTCCATGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_004881.2-1123s1c1
Sequence:CCGGCTCTGAAGCAACGCTGAAATTCTCGAGAATTTCAGCGTTGCTTCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155522    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004881.2-1130s1c1
Sequence:CCGGGCAACGCTGAAATTCACCAAACTCGAGTTTGGTGAATTTCAGCGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155268    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004881.2-1366s1c1
Sequence:CCGGGAATGCTTTCACGGAGCAAATCTCGAGATTTGCTCCGTGAAAGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004881.2-1151s21c1
Sequence:CCGGGGTGCTGGAGTTAATCTTATTCTCGAGAATAAGATTAACTCCAGCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004881.2-1086s21c1
Sequence:CCGGGAGCAGCTGCTGGATTCAATTCTCGAGAATTGAATCCAGCAGCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks