EMAIL THIS PAGE TO A FRIEND

TP53INP1

tumor protein p53 inducible nuclear protein 1

Synonyms: SIP TP53DINP1 TP53INP1A TP53INP1B Teap p53DINP1
UniProtKB ID: Q96A56, B2RCE5, Q969R9
Gene ID:
Rat(297822) tumor protein p53 inducible nuclear protein 1
Zebrafish(568021) tumor protein p53 inducible nuclear protein 1
domestic cat(101085856) tumor protein p53 inducible nuclear protein 1
dog(611710) tumor protein p53 inducible nuclear protein 1
chicken(420232) tumor protein p53 inducible nuclear protein 1
cow(782667) tumor protein p53 inducible nuclear protein 1
sheep(101109367) tumor protein p53 inducible nuclear protein 1
domestic guinea pig(100732175) tumor protein p53 inducible nuclear protein 1
naked mole-rat(101702895) tumor protein p53 inducible nuclear protein 1
292 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033285 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033285 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033285 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU044501 MISSION® esiRNA esiRNA human TP53INP1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033285 Rosetta Predictions human pricing
NM_181084 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033285 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00220457 predicted 561
2 SASI_Hs02_00361089 predicted 944
3 SASI_Hs01_00220458 predicted 1159
4 SASI_Hs01_00220459 predicted 609
5 SASI_Hs02_00361090 predicted 695
6 SASI_Hs01_00220460 predicted 548
7 SASI_Hs01_00220461 predicted 1060
8 SASI_Hs01_00220462 predicted 965
9 SASI_Hs01_00220465 predicted 743
10 SASI_Hs02_00361091 predicted 684
11 SASI_Hs01_00220463 predicted 409
12 SASI_Hs01_00220464 predicted 1168
13 SASI_Hs01_00220466 predicted 862
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181084 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00033651 predicted 215
2 SASI_Rn01_00033652 predicted 505
3 SASI_Rn01_00033653 predicted 451
4 SASI_Rn01_00033654 predicted 368
5 SASI_Rn01_00033655 predicted 460
6 SASI_Rn01_00033656 predicted 553
7 SASI_Rn01_00033657 predicted 432
8 SASI_Rn01_00033658 predicted 748
9 SASI_Rn01_00033659 predicted 332
10 SASI_Rn01_00033660 predicted 731
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033285
VALIDATED
TP53INP1 MISSION shRNA Bacterial Glycerol Stock
tumor protein p53 inducible nuclear protein 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150079    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033285.2-864s1c1
Sequence:CCGGCATTGTTATGTTGCAGCTCTTCTCGAGAAGAGCTGCAACATAACAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033285.2-799s1c1
Sequence:CCGGCTGATGAATTACATAGCCCAACTCGAGTTGGGCTATGTAATTCATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149881    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033285.2-4588s1c1
Sequence:CCGGGCCTTCTATCTTGGATGGTTTCTCGAGAAACCATCCAAGATAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149560    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_033285.2-3834s1c1
Sequence:CCGGGCGCCATGTTTCTCAAAGTTTCTCGAGAAACTTTGAGAAACATGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147821    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_033285.2-2622s1c1
Sequence:CCGGGCCTTCATAATCAAACAGCTTCTCGAGAAGCTGTTTGATTATGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149477    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033285.2-580s1c1
Sequence:CCGGGCTTGGCTGATACAAGTGATTCTCGAGAATCACTTGTATCAGCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_033285.2-464s1c1
Sequence:CCGGCATAGATACTTGCACTGGTTTCTCGAGAAACCAGTGCAAGTATCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130160    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033285.2-4095s1c1
Sequence:CCGGCCATGCAAACTGTTCCTGTTTCTCGAGAAACAGGAACAGTTTGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_033285.2-963s1c1
Sequence:CCGGCCTCTTAACAGAAATAGCCTTCTCGAGAAGGCTATTTCTGTTAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033285.2-692s1c1
Sequence:CCGGCAAGGTGGAAACAAGTCCTATCTCGAGATAGGACTTGTTTCCACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033285
VALIDATED
TP53INP1 MISSION shRNA shRNA Plasmid DNA
tumor protein p53 inducible nuclear protein 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150079    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033285.2-864s1c1
Sequence:CCGGCATTGTTATGTTGCAGCTCTTCTCGAGAAGAGCTGCAACATAACAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033285.2-799s1c1
Sequence:CCGGCTGATGAATTACATAGCCCAACTCGAGTTGGGCTATGTAATTCATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149881    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033285.2-4588s1c1
Sequence:CCGGGCCTTCTATCTTGGATGGTTTCTCGAGAAACCATCCAAGATAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149560    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_033285.2-3834s1c1
Sequence:CCGGGCGCCATGTTTCTCAAAGTTTCTCGAGAAACTTTGAGAAACATGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147821    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_033285.2-2622s1c1
Sequence:CCGGGCCTTCATAATCAAACAGCTTCTCGAGAAGCTGTTTGATTATGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149477    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033285.2-580s1c1
Sequence:CCGGGCTTGGCTGATACAAGTGATTCTCGAGAATCACTTGTATCAGCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_033285.2-464s1c1
Sequence:CCGGCATAGATACTTGCACTGGTTTCTCGAGAAACCAGTGCAAGTATCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130160    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033285.2-4095s1c1
Sequence:CCGGCCATGCAAACTGTTCCTGTTTCTCGAGAAACAGGAACAGTTTGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_033285.2-963s1c1
Sequence:CCGGCCTCTTAACAGAAATAGCCTTCTCGAGAAGGCTATTTCTGTTAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033285.2-692s1c1
Sequence:CCGGCAAGGTGGAAACAAGTCCTATCTCGAGATAGGACTTGTTTCCACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033285
VALIDATED
TP53INP1 MISSION shRNA Lentiviral Transduction Particles
tumor protein p53 inducible nuclear protein 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150079    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033285.2-864s1c1
Sequence:CCGGCATTGTTATGTTGCAGCTCTTCTCGAGAAGAGCTGCAACATAACAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033285.2-799s1c1
Sequence:CCGGCTGATGAATTACATAGCCCAACTCGAGTTGGGCTATGTAATTCATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149881    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033285.2-4588s1c1
Sequence:CCGGGCCTTCTATCTTGGATGGTTTCTCGAGAAACCATCCAAGATAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149560    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_033285.2-3834s1c1
Sequence:CCGGGCGCCATGTTTCTCAAAGTTTCTCGAGAAACTTTGAGAAACATGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147821    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_033285.2-2622s1c1
Sequence:CCGGGCCTTCATAATCAAACAGCTTCTCGAGAAGCTGTTTGATTATGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149477    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033285.2-580s1c1
Sequence:CCGGGCTTGGCTGATACAAGTGATTCTCGAGAATCACTTGTATCAGCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_033285.2-464s1c1
Sequence:CCGGCATAGATACTTGCACTGGTTTCTCGAGAAACCAGTGCAAGTATCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130160    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033285.2-4095s1c1
Sequence:CCGGCCATGCAAACTGTTCCTGTTTCTCGAGAAACAGGAACAGTTTGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_033285.2-963s1c1
Sequence:CCGGCCTCTTAACAGAAATAGCCTTCTCGAGAAGGCTATTTCTGTTAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033285.2-692s1c1
Sequence:CCGGCAAGGTGGAAACAAGTCCTATCTCGAGATAGGACTTGTTTCCACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks