EMAIL THIS PAGE TO A FRIEND

TP53INP2

tumor protein p53 inducible nuclear protein 2

Synonyms: C20orf110 DOR PINH dJ1181N3.1
UniProtKB ID: Q8IXH6, A8K8S8, E1P5P6, Q5JX64, Q8IYL5, Q9NU00
Gene ID:
Rat(362246) tumor protein p53 inducible nuclear protein 2
naked mole-rat(101708070) tumor protein p53 inducible nuclear protein 2
domestic guinea pig(100729804) tumor protein p53 inducible nuclear protein 2
cow(511340) tumor protein p53 inducible nuclear protein 2
sheep(101119069) tumor protein p53 inducible nuclear protein 2
chicken(769066) tumor protein p53 inducible nuclear protein 2
dog(610064) tumor protein p53 inducible nuclear protein 2
domestic cat(101088919) tumor protein p53 inducible nuclear protein 2
242 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021202 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021202 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021202 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021202 Rosetta Predictions human pricing
XM_001063870 Rosetta Predictions rat pricing
XM_001063973 Rosetta Predictions rat pricing
XM_001074013 Rosetta Predictions rat pricing
XM_342551 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021202 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00107877 predicted 1151
2 SASI_Hs01_00107874 predicted 1384
3 SASI_Hs02_00354789 predicted 1449
4 SASI_Hs01_00107873 predicted 1431
5 SASI_Hs02_00354790 predicted 1448
6 SASI_Hs01_00107875 predicted 1072
7 SASI_Hs01_00107876 predicted 1095
8 SASI_Hs01_00107878 predicted 1401
9 SASI_Hs01_00107879 predicted 1080
10 SASI_Hs01_00107880 predicted 1399
11 SASI_Hs01_00107881 predicted 989
12 SASI_Hs01_00107882 predicted 1430
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063870 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00308539 predicted 995
2 SASI_Rn02_00308540 predicted 269
3 SASI_Rn02_00308541 predicted 552
4 SASI_Rn02_00308542 predicted 380
5 SASI_Rn02_00308543 predicted 1017
6 SASI_Rn02_00308544 predicted 489
7 SASI_Rn02_00308545 predicted 733
8 SASI_Rn02_00308546 predicted 1027
9 SASI_Rn02_00308547 predicted 759
10 SASI_Rn02_00308548 predicted 1008
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063973 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00308911 predicted 1060
2 SASI_Rn02_00308912 predicted 336
3 SASI_Rn02_00308913 predicted 625
4 SASI_Rn02_00308914 predicted 443
5 SASI_Rn02_00308915 predicted 1079
6 SASI_Rn02_00308916 predicted 553
7 SASI_Rn02_00308917 predicted 792
8 SASI_Rn02_00308918 predicted 1094
9 SASI_Rn02_00308919 predicted 823
10 SASI_Rn02_00308920 predicted 1068
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001074013 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00344787 predicted 1059
2 SASI_Rn02_00344788 predicted 339
3 SASI_Rn02_00344789 predicted 621
4 SASI_Rn02_00344790 predicted 445
5 SASI_Rn02_00344791 predicted 1081
6 SASI_Rn02_00344792 predicted 557
7 SASI_Rn02_00344793 predicted 795
8 SASI_Rn02_00344794 predicted 1093
9 SASI_Rn02_00344795 predicted 817
10 SASI_Rn02_00344796 predicted 1067
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342551 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00394459 predicted 993
2 SASI_Rn02_00394460 predicted 268
3 SASI_Rn02_00394461 predicted 553
4 SASI_Rn02_00394462 predicted 380
5 SASI_Rn02_00394463 predicted 1017
6 SASI_Rn02_00394464 predicted 488
7 SASI_Rn02_00394465 predicted 735
8 SASI_Rn02_00394466 predicted 1027
9 SASI_Rn02_00394467 predicted 751
10 SASI_Rn02_00394468 predicted 1002
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021202
TP53INP2 MISSION shRNA Bacterial Glycerol Stock
tumor protein p53 inducible nuclear protein 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166445    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021202.1-944s1c1
Sequence:CCGGCAAGAACCAGAGCAGCTTCATCTCGAGATGAAGCTGCTCTGGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160047    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021202.1-2771s1c1
Sequence:CCGGCCAGGGAATAAGCCAAATTAACTCGAGTTAATTTGGCTTATTCCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160166    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021202.1-1432s1c1
Sequence:CCGGCCTGTTCCCTTATTCTTCATTCTCGAGAATGAAGAATAAGGGAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161076    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021202.1-2272s1c1
Sequence:CCGGGCCTCTCTTTCTTTCTAGGTTCTCGAGAACCTAGAAAGAAAGAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162043    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021202.1-3792s1c1
Sequence:CCGGCCTAGATCCATGTGGCTTTATCTCGAGATAAAGCCACATGGATCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164690    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021202.1-1864s1c1
Sequence:CCGGCCCTGAAATCTGAAGGGCTTACTCGAGTAAGCCCTTCAGATTTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165135    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021202.1-3651s1c1
Sequence:CCGGGCACCGTGTATGAATGCAGTTCTCGAGAACTGCATTCATACACGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165975    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021202.1-947s1c1
Sequence:CCGGGAACCAGAGCAGCTTCATCTACTCGAGTAGATGAAGCTGCTCTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021202.1-978s21c1
Sequence:CCGGCAGCGCCAGTTCAACTACTGACTCGAGTCAGTAGTTGAACTGGCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416349    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021202.1-1403s21c1
Sequence:CCGGACTATCCCATGGTTGGCATTACTCGAGTAATGCCAACCATGGGATAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021202.1-430s21c1
Sequence:CCGGTGGACGGCTGGCTCATCATTGCTCGAGCAATGATGAGCCAGCCGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021202
TP53INP2 MISSION shRNA shRNA Plasmid DNA
tumor protein p53 inducible nuclear protein 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166445    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021202.1-944s1c1
Sequence:CCGGCAAGAACCAGAGCAGCTTCATCTCGAGATGAAGCTGCTCTGGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160047    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021202.1-2771s1c1
Sequence:CCGGCCAGGGAATAAGCCAAATTAACTCGAGTTAATTTGGCTTATTCCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160166    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021202.1-1432s1c1
Sequence:CCGGCCTGTTCCCTTATTCTTCATTCTCGAGAATGAAGAATAAGGGAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161076    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021202.1-2272s1c1
Sequence:CCGGGCCTCTCTTTCTTTCTAGGTTCTCGAGAACCTAGAAAGAAAGAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162043    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021202.1-3792s1c1
Sequence:CCGGCCTAGATCCATGTGGCTTTATCTCGAGATAAAGCCACATGGATCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164690    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021202.1-1864s1c1
Sequence:CCGGCCCTGAAATCTGAAGGGCTTACTCGAGTAAGCCCTTCAGATTTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165135    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021202.1-3651s1c1
Sequence:CCGGGCACCGTGTATGAATGCAGTTCTCGAGAACTGCATTCATACACGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165975    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021202.1-947s1c1
Sequence:CCGGGAACCAGAGCAGCTTCATCTACTCGAGTAGATGAAGCTGCTCTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021202.1-978s21c1
Sequence:CCGGCAGCGCCAGTTCAACTACTGACTCGAGTCAGTAGTTGAACTGGCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416349    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021202.1-1403s21c1
Sequence:CCGGACTATCCCATGGTTGGCATTACTCGAGTAATGCCAACCATGGGATAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021202.1-430s21c1
Sequence:CCGGTGGACGGCTGGCTCATCATTGCTCGAGCAATGATGAGCCAGCCGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021202
TP53INP2 MISSION shRNA Lentiviral Transduction Particles
tumor protein p53 inducible nuclear protein 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166445    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021202.1-944s1c1
Sequence:CCGGCAAGAACCAGAGCAGCTTCATCTCGAGATGAAGCTGCTCTGGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160047    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021202.1-2771s1c1
Sequence:CCGGCCAGGGAATAAGCCAAATTAACTCGAGTTAATTTGGCTTATTCCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160166    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021202.1-1432s1c1
Sequence:CCGGCCTGTTCCCTTATTCTTCATTCTCGAGAATGAAGAATAAGGGAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161076    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021202.1-2272s1c1
Sequence:CCGGGCCTCTCTTTCTTTCTAGGTTCTCGAGAACCTAGAAAGAAAGAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162043    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021202.1-3792s1c1
Sequence:CCGGCCTAGATCCATGTGGCTTTATCTCGAGATAAAGCCACATGGATCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164690    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021202.1-1864s1c1
Sequence:CCGGCCCTGAAATCTGAAGGGCTTACTCGAGTAAGCCCTTCAGATTTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165135    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021202.1-3651s1c1
Sequence:CCGGGCACCGTGTATGAATGCAGTTCTCGAGAACTGCATTCATACACGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165975    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021202.1-947s1c1
Sequence:CCGGGAACCAGAGCAGCTTCATCTACTCGAGTAGATGAAGCTGCTCTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021202.1-978s21c1
Sequence:CCGGCAGCGCCAGTTCAACTACTGACTCGAGTCAGTAGTTGAACTGGCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416349    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021202.1-1403s21c1
Sequence:CCGGACTATCCCATGGTTGGCATTACTCGAGTAATGCCAACCATGGGATAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021202.1-430s21c1
Sequence:CCGGTGGACGGCTGGCTCATCATTGCTCGAGCAATGATGAGCCAGCCGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks