EMAIL THIS PAGE TO A FRIEND

TP53RK

TP53 regulating kinase

Synonyms: BUD32 C20orf64 Nori-2 Nori-2p PRPK dJ101A2
Gene ID:
Rat(362272) TP53 regulating kinase
Zebrafish(553571) TP53 regulating kinase
chicken(428145) TP53 regulating kinase
domestic cat(101084351) TP53 regulating kinase
dog(611235) TP53 regulating kinase
cow(619100) TP53 regulating kinase
sheep(101118291) TP53 regulating kinase
domestic guinea pig(100730721) TP53 regulating kinase
naked mole-rat(101712541) TP53 regulating kinase
50 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1300461 Anti-PRPK (center) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB1305423 ANTI-PRPK (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human
immunohistochemistry, western blot pricing
T8077 Anti-TP53RK (61-75) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
HPA015837 Anti-TP53RK antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
WH0112858M1 Monoclonal Anti-TP53RK antibody produced in mouse clone 4B9-1H3, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1408829 Monoclonal Anti-TP53RK antibody produced in mouse clone 3D7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence pricing
SAB1408830 Monoclonal Anti-TP53RK antibody produced in mouse clone 2E8, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry pricing
SAB1408831 Monoclonal Anti-TP53RK antibody produced in mouse clone 3H4, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1405333 Monoclonal Anti-TP53RK, (C-terminal) antibody produced in mouse clone 2A9, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033550 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033550 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033550 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU005331 MISSION® esiRNA esiRNA targeting human TP53RK (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033550 Rosetta Predictions human pricing
NM_001108606 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033550 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00010751 predicted 1105
2 SASI_Hs01_00010752 predicted 759
3 SASI_Hs01_00010753 predicted 533
4 SASI_Hs01_00010755 predicted 1090
5 SASI_Hs01_00010756 predicted 1116
6 SASI_Hs02_00361425 predicted 858
7 SASI_Hs02_00361426 predicted 528
8 SASI_Hs01_00010757 predicted 1063
9 SASI_Hs01_00010758 predicted 839
10 SASI_Hs01_00010759 predicted 650
11 SASI_Hs01_00010754 predicted 765
12 SASI_Hs01_00010760 predicted 637
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108606 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00240289 predicted 1271
2 SASI_Rn02_00240290 predicted 956
3 SASI_Rn02_00240291 predicted 1188
4 SASI_Rn02_00240292 predicted 924
5 SASI_Rn02_00240293 predicted 1242
6 SASI_Rn02_00240294 predicted 1383
7 SASI_Rn02_00240295 predicted 1139
8 SASI_Rn02_00240296 predicted 1058
9 SASI_Rn02_00240297 predicted 963
10 SASI_Rn02_00240298 predicted 1369
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033550
VALIDATED
TP53RK MISSION shRNA Bacterial Glycerol Stock
TP53 regulating kinase
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000380544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033550.3-741s21c1
Sequence:GTACCGGCCCTGGAACAGCTGAACATTGCTCGAGCAATGTTCAGCTGTTCCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033550.3-771s21c1
Sequence:CCGGACTTTGGGCTGAGTTTCATTTCTCGAGAAATGAAACTCAGCCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033550.3-579s21c1
Sequence:CCGGCAGTGACTGTTCGAGATTATACTCGAGTATAATCTCGAACAGTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033550.3-539s21c1
Sequence:CCGGTATGCTTCCAACTGCTTATATCTCGAGATATAAGCAGTTGGAAGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033550.3-857s21c1
Sequence:CCGGCCCAACACTGAAACTGTGTTTCTCGAGAAACACAGTTTCAGTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344809    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033550.3-1065s21c1
Sequence:CCGGGATCTAAGTAAAGGTGTTAAGCTCGAGCTTAACACCTTTACTTAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033550.3-800s1c1
Sequence:CCGGCCAGAGGATAAGGGAGTAGACCTCGAGGTCTACTCCCTTATCCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_033550.3-689s1c1
Sequence:CCGGGAAGACCTCATTCATGGTGATCTCGAGATCACCATGAATGAGGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_033550.3-883s1c1
Sequence:CCGGCTTTCTGAAGAGCTACTCCACCTCGAGGTGGAGTAGCTCTTCAGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033550.3-547s1c1
Sequence:CCGGCAACTGCTTATATATGGAAGACTCGAGTCTTCCATATATAAGCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196427    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_033550.3-1065s1c1
Sequence:CCGGGATCTAAGTAAAGGTGTTAAGCTCGAGCTTAACACCTTTACTTAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_033550.3-602s1c1
Sequence:CCGGCAGTCCACTATGGAGACTGAACTCGAGTTCAGTCTCCATAGTGGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_033550.3-857s1c1
Sequence:CCGGCCCAACACTGAAACTGTGTTTCTCGAGAAACACAGTTTCAGTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033550.3-716s1c1
Sequence:CCGGACCTCCAACATGCTCCTGAAACTCGAGTTTCAGGAGCATGTTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033550.3-591s1c1
Sequence:CCGGGAGATTATATTCAGTCCACTACTCGAGTAGTGGACTGAATATAATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033550.3-766s1c1
Sequence:CCGGCATAGACTTTGGGCTGAGTTTCTCGAGAAACTCAGCCCAAAGTCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033550
VALIDATED
TP53RK MISSION shRNA shRNA Plasmid DNA
TP53 regulating kinase
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000380544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033550.3-741s21c1
Sequence:GTACCGGCCCTGGAACAGCTGAACATTGCTCGAGCAATGTTCAGCTGTTCCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033550.3-771s21c1
Sequence:CCGGACTTTGGGCTGAGTTTCATTTCTCGAGAAATGAAACTCAGCCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033550.3-579s21c1
Sequence:CCGGCAGTGACTGTTCGAGATTATACTCGAGTATAATCTCGAACAGTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033550.3-539s21c1
Sequence:CCGGTATGCTTCCAACTGCTTATATCTCGAGATATAAGCAGTTGGAAGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033550.3-857s21c1
Sequence:CCGGCCCAACACTGAAACTGTGTTTCTCGAGAAACACAGTTTCAGTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344809    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033550.3-1065s21c1
Sequence:CCGGGATCTAAGTAAAGGTGTTAAGCTCGAGCTTAACACCTTTACTTAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033550.3-800s1c1
Sequence:CCGGCCAGAGGATAAGGGAGTAGACCTCGAGGTCTACTCCCTTATCCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_033550.3-689s1c1
Sequence:CCGGGAAGACCTCATTCATGGTGATCTCGAGATCACCATGAATGAGGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_033550.3-883s1c1
Sequence:CCGGCTTTCTGAAGAGCTACTCCACCTCGAGGTGGAGTAGCTCTTCAGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033550.3-547s1c1
Sequence:CCGGCAACTGCTTATATATGGAAGACTCGAGTCTTCCATATATAAGCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196427    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_033550.3-1065s1c1
Sequence:CCGGGATCTAAGTAAAGGTGTTAAGCTCGAGCTTAACACCTTTACTTAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_033550.3-602s1c1
Sequence:CCGGCAGTCCACTATGGAGACTGAACTCGAGTTCAGTCTCCATAGTGGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_033550.3-857s1c1
Sequence:CCGGCCCAACACTGAAACTGTGTTTCTCGAGAAACACAGTTTCAGTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033550.3-716s1c1
Sequence:CCGGACCTCCAACATGCTCCTGAAACTCGAGTTTCAGGAGCATGTTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033550.3-591s1c1
Sequence:CCGGGAGATTATATTCAGTCCACTACTCGAGTAGTGGACTGAATATAATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033550.3-766s1c1
Sequence:CCGGCATAGACTTTGGGCTGAGTTTCTCGAGAAACTCAGCCCAAAGTCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033550
VALIDATED
TP53RK MISSION shRNA Lentiviral Transduction Particles
TP53 regulating kinase
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000380544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033550.3-741s21c1
Sequence:GTACCGGCCCTGGAACAGCTGAACATTGCTCGAGCAATGTTCAGCTGTTCCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033550.3-771s21c1
Sequence:CCGGACTTTGGGCTGAGTTTCATTTCTCGAGAAATGAAACTCAGCCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033550.3-579s21c1
Sequence:CCGGCAGTGACTGTTCGAGATTATACTCGAGTATAATCTCGAACAGTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033550.3-539s21c1
Sequence:CCGGTATGCTTCCAACTGCTTATATCTCGAGATATAAGCAGTTGGAAGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033550.3-857s21c1
Sequence:CCGGCCCAACACTGAAACTGTGTTTCTCGAGAAACACAGTTTCAGTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344809    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033550.3-1065s21c1
Sequence:CCGGGATCTAAGTAAAGGTGTTAAGCTCGAGCTTAACACCTTTACTTAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033550.3-800s1c1
Sequence:CCGGCCAGAGGATAAGGGAGTAGACCTCGAGGTCTACTCCCTTATCCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_033550.3-689s1c1
Sequence:CCGGGAAGACCTCATTCATGGTGATCTCGAGATCACCATGAATGAGGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_033550.3-883s1c1
Sequence:CCGGCTTTCTGAAGAGCTACTCCACCTCGAGGTGGAGTAGCTCTTCAGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033550.3-547s1c1
Sequence:CCGGCAACTGCTTATATATGGAAGACTCGAGTCTTCCATATATAAGCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196427    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_033550.3-1065s1c1
Sequence:CCGGGATCTAAGTAAAGGTGTTAAGCTCGAGCTTAACACCTTTACTTAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_033550.3-602s1c1
Sequence:CCGGCAGTCCACTATGGAGACTGAACTCGAGTTCAGTCTCCATAGTGGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_033550.3-857s1c1
Sequence:CCGGCCCAACACTGAAACTGTGTTTCTCGAGAAACACAGTTTCAGTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033550.3-716s1c1
Sequence:CCGGACCTCCAACATGCTCCTGAAACTCGAGTTTCAGGAGCATGTTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033550.3-591s1c1
Sequence:CCGGGAGATTATATTCAGTCCACTACTCGAGTAGTGGACTGAATATAATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033550.3-766s1c1
Sequence:CCGGCATAGACTTTGGGCTGAGTTTCTCGAGAAACTCAGCCCAAAGTCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks