EMAIL THIS PAGE TO A FRIEND

TP53TG3

TP53 target 3

Synonyms: P53TG3 TP53TG3A
Species: Human TP53TG3(24150)
UniProtKB ID: Q9ULZ0, B2R5K6, Q4KN31, Q9ULY9
Gene ID:
18 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1101843 Anti-TP53TG3 (21-35) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015369 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015369 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015369 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016212 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016212 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00349063 predicted 858
2 SASI_Hs01_00124836 predicted 997
3 SASI_Hs02_00349064 predicted 799
4 SASI_Hs01_00124837 predicted 861
5 SASI_Hs01_00124838 predicted 849
6 SASI_Hs01_00124840 predicted 719
7 SASI_Hs01_00124841 predicted 797
8 SASI_Hs01_00124842 predicted 719
9 SASI_Hs02_00349065 predicted 846
10 SASI_Hs02_00349066 predicted 785
11 SASI_Hs01_00124839 predicted 863
12 SASI_Hs01_00124843 predicted 914
13 SASI_Hs01_00124844 predicted 1166
14 SASI_Hs01_00124845 predicted 1098
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015369
TP53TG3 MISSION shRNA Bacterial Glycerol Stock
TP53 target 3
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166489    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015369.1-255s1c1
Sequence:CCGGCGGCTAGTTTCACCTGGTAATCTCGAGATTACCAGGTGAAACTAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160563    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015369.1-661s1c1
Sequence:CCGGCAGTGTAATAAAGAGGAGAAACTCGAGTTTCTCCTCTTTATTACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161393    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015369.1-328s1c1
Sequence:CCGGGTTTGATACCTTGCAGATCAACTCGAGTTGATCTGCAAGGTATCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161448    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015369.1-313s1c1
Sequence:CCGGCTTGTCATGTTCGAAGTTTGACTCGAGTCAAACTTCGAACATGACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161984    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015369.1-325s1c1
Sequence:CCGGGAAGTTTGATACCTTGCAGATCTCGAGATCTGCAAGGTATCAAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165341    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015369.1-231s1c1
Sequence:CCGGGCTGAAGAGACATTGGAGCTACTCGAGTAGCTCCAATGTCTCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165971    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015369.1-271s1c1
Sequence:CCGGGTAATTGTGACACCCTGTCTCCTCGAGGAGACAGGGTGTCACAATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164925    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015369.1-214s1c1
Sequence:CCGGGTTTCCAAATCTCTCCTGCTGCTCGAGCAGCAGGAGAGATTTGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164242    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015369.1-207s1c1
Sequence:CCGGCCTTGCTGTTTCCAAATCTCTCTCGAGAGAGATTTGGAAACAGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166032    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015369.1-268s1c1
Sequence:CCGGCTGGTAATTGTGACACCCTGTCTCGAGACAGGGTGTCACAATTACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159887    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015369.1-978s1c1
Sequence:CCGGGCAGTATTTGGAAGAAACAAACTCGAGTTTGTTTCTTCCAAATACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015369
TP53TG3 MISSION shRNA shRNA Plasmid DNA
TP53 target 3
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166489    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015369.1-255s1c1
Sequence:CCGGCGGCTAGTTTCACCTGGTAATCTCGAGATTACCAGGTGAAACTAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160563    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015369.1-661s1c1
Sequence:CCGGCAGTGTAATAAAGAGGAGAAACTCGAGTTTCTCCTCTTTATTACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161393    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015369.1-328s1c1
Sequence:CCGGGTTTGATACCTTGCAGATCAACTCGAGTTGATCTGCAAGGTATCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161448    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015369.1-313s1c1
Sequence:CCGGCTTGTCATGTTCGAAGTTTGACTCGAGTCAAACTTCGAACATGACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161984    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015369.1-325s1c1
Sequence:CCGGGAAGTTTGATACCTTGCAGATCTCGAGATCTGCAAGGTATCAAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165341    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015369.1-231s1c1
Sequence:CCGGGCTGAAGAGACATTGGAGCTACTCGAGTAGCTCCAATGTCTCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165971    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015369.1-271s1c1
Sequence:CCGGGTAATTGTGACACCCTGTCTCCTCGAGGAGACAGGGTGTCACAATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164925    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015369.1-214s1c1
Sequence:CCGGGTTTCCAAATCTCTCCTGCTGCTCGAGCAGCAGGAGAGATTTGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164242    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015369.1-207s1c1
Sequence:CCGGCCTTGCTGTTTCCAAATCTCTCTCGAGAGAGATTTGGAAACAGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166032    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015369.1-268s1c1
Sequence:CCGGCTGGTAATTGTGACACCCTGTCTCGAGACAGGGTGTCACAATTACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159887    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015369.1-978s1c1
Sequence:CCGGGCAGTATTTGGAAGAAACAAACTCGAGTTTGTTTCTTCCAAATACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015369
TP53TG3 MISSION shRNA Lentiviral Transduction Particles
TP53 target 3
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166489    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015369.1-255s1c1
Sequence:CCGGCGGCTAGTTTCACCTGGTAATCTCGAGATTACCAGGTGAAACTAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160563    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015369.1-661s1c1
Sequence:CCGGCAGTGTAATAAAGAGGAGAAACTCGAGTTTCTCCTCTTTATTACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161393    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015369.1-328s1c1
Sequence:CCGGGTTTGATACCTTGCAGATCAACTCGAGTTGATCTGCAAGGTATCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161448    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015369.1-313s1c1
Sequence:CCGGCTTGTCATGTTCGAAGTTTGACTCGAGTCAAACTTCGAACATGACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161984    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015369.1-325s1c1
Sequence:CCGGGAAGTTTGATACCTTGCAGATCTCGAGATCTGCAAGGTATCAAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165341    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015369.1-231s1c1
Sequence:CCGGGCTGAAGAGACATTGGAGCTACTCGAGTAGCTCCAATGTCTCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165971    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015369.1-271s1c1
Sequence:CCGGGTAATTGTGACACCCTGTCTCCTCGAGGAGACAGGGTGTCACAATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164925    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015369.1-214s1c1
Sequence:CCGGGTTTCCAAATCTCTCCTGCTGCTCGAGCAGCAGGAGAGATTTGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164242    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015369.1-207s1c1
Sequence:CCGGCCTTGCTGTTTCCAAATCTCTCTCGAGAGAGATTTGGAAACAGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166032    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015369.1-268s1c1
Sequence:CCGGCTGGTAATTGTGACACCCTGTCTCGAGACAGGGTGTCACAATTACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159887    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015369.1-978s1c1
Sequence:CCGGGCAGTATTTGGAAGAAACAAACTCGAGTTTGTTTCTTCCAAATACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks