EMAIL THIS PAGE TO A FRIEND

TP53TG5

TP53 target 5

Synonyms: C20orf10 CLG01
UniProtKB ID: Q9Y2B4
Gene ID:
chicken(419181) TP53 target 5
dog(477242) TP53 target 5
domestic cat(101088399) TP53 target 5
cow(100138069) TP53 target 5
sheep(101109202) TP53 target 5
20 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014477 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014477 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014477 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU038531 MISSION® esiRNA esiRNA human C20orf10 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014477 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014477 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00033329 predicted 287
2 SASI_Hs01_00033330 predicted 381
3 SASI_Hs01_00033331 predicted 536
4 SASI_Hs01_00033332 predicted 207
5 SASI_Hs01_00033333 predicted 291
6 SASI_Hs01_00033334 predicted 290
7 SASI_Hs01_00033335 predicted 237
8 SASI_Hs01_00033336 predicted 256
9 SASI_Hs01_00033337 predicted 237
10 SASI_Hs01_00033338 predicted 292
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014477
TP53TG5 MISSION shRNA Bacterial Glycerol Stock
TP53 target 5
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014477.2-162s21c1
Sequence:CCGGGCAGCCTGTGAGCAAAGTAATCTCGAGATTACTTTGCTCACAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014477.2-807s21c1
Sequence:CCGGCTGCTCCGCATCACTTGAAATCTCGAGATTTCAAGTGATGCGGAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014477.2-639s21c1
Sequence:CCGGCATTAAGCCCTACCGCAATAGCTCGAGCTATTGCGGTAGGGCTTAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014477.2-192s21c1
Sequence:CCGGCCGTCTGAGAACGGTGTTAAACTCGAGTTTAACACCGTTCTCAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130944    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014477.2-399s1c1
Sequence:CCGGCGAGAAGGAACTCAAGTCCAACTCGAGTTGGACTTGAGTTCCTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129453    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014477.2-262s1c1
Sequence:CCGGGAACTGCATAAGCTGGCCAAACTCGAGTTTGGCCAGCTTATGCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014477
TP53TG5 MISSION shRNA shRNA Plasmid DNA
TP53 target 5
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014477.2-162s21c1
Sequence:CCGGGCAGCCTGTGAGCAAAGTAATCTCGAGATTACTTTGCTCACAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014477.2-807s21c1
Sequence:CCGGCTGCTCCGCATCACTTGAAATCTCGAGATTTCAAGTGATGCGGAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014477.2-639s21c1
Sequence:CCGGCATTAAGCCCTACCGCAATAGCTCGAGCTATTGCGGTAGGGCTTAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014477.2-192s21c1
Sequence:CCGGCCGTCTGAGAACGGTGTTAAACTCGAGTTTAACACCGTTCTCAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130944    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014477.2-399s1c1
Sequence:CCGGCGAGAAGGAACTCAAGTCCAACTCGAGTTGGACTTGAGTTCCTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129453    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014477.2-262s1c1
Sequence:CCGGGAACTGCATAAGCTGGCCAAACTCGAGTTTGGCCAGCTTATGCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014477
TP53TG5 MISSION shRNA Lentiviral Transduction Particles
TP53 target 5
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014477.2-162s21c1
Sequence:CCGGGCAGCCTGTGAGCAAAGTAATCTCGAGATTACTTTGCTCACAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014477.2-807s21c1
Sequence:CCGGCTGCTCCGCATCACTTGAAATCTCGAGATTTCAAGTGATGCGGAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014477.2-639s21c1
Sequence:CCGGCATTAAGCCCTACCGCAATAGCTCGAGCTATTGCGGTAGGGCTTAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014477.2-192s21c1
Sequence:CCGGCCGTCTGAGAACGGTGTTAAACTCGAGTTTAACACCGTTCTCAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130944    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014477.2-399s1c1
Sequence:CCGGCGAGAAGGAACTCAAGTCCAACTCGAGTTGGACTTGAGTTCCTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129453    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014477.2-262s1c1
Sequence:CCGGGAACTGCATAAGCTGGCCAAACTCGAGTTTGGCCAGCTTATGCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks