EMAIL THIS PAGE TO A FRIEND

TP63

tumor protein p63

Synonyms: AIS B(p51A) B(p51B) EEC3 KET LMS NBP OFC8 RHS SHFM4 TP53CP TP53L TP73L p40 p51 p53CP p63 p73H p73L
Gene ID:
Human(8626) Summary: This gene encodes a member of the p53 family of transcription factors. An animal model, p63 -/- mice, has been useful in defining the role this protein plays in the development and maintenance of stratified epithelial tissues. p63 -/- mice have several developmental defects which include the lack of limbs and other tissues, such as teeth and mammary glands, which develop as a result of interactions between mesenchyme and epithelium. Mutations in this gene are associated with ectodermal dysplasia, and cleft lip/palate syndrome 3 (EEC3); split-hand/foot malformation 4 (SHFM4); ankyloblepharon-ectodermal defects-cleft lip/palate; ADULT syndrome (acro-dermato-ungual-lacrimal-tooth); limb-mammary syndrome; Rap-Hodgkin syndrome (RHS); and orofacial cleft 8. Both alternative splicing and the use of alternative promoters results in multiple transcript variants encoding different proteins. Many transcripts encoding different proteins have been reported but the biological validity and the full-length nature of these variants have not been determined. [provided by RefSeq, Jul 2008]
Rat(246334) tumor protein p63
cow(615335) tumor protein p63
sheep(101108874) tumor protein p63
sheep(100048992) tumor protein p63
domestic guinea pig(100732143) tumor protein p63
naked mole-rat(101710600) tumor protein p63
Zebrafish(260407) tumor protein p63
Horse(100059752) tumor protein p63
domestic cat(101095124) tumor protein p63
chicken(374269) tumor protein p63
dog(488125) tumor protein p63
334 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003722 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003722 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003722 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU122601 MISSION® esiRNA esiRNA human TP63 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001114978 Rosetta Predictions human pricing
NM_001114979 Rosetta Predictions human pricing
NM_001114980 Rosetta Predictions human pricing
NM_001114981 Rosetta Predictions human pricing
NM_001114982 Rosetta Predictions human pricing
NM_003722 Rosetta Predictions human pricing
NM_001127339 Rosetta Predictions rat pricing
NM_001127341 Rosetta Predictions rat pricing
NM_001127342 Rosetta Predictions rat pricing
NM_001127343 Rosetta Predictions rat pricing
NM_001127344 Rosetta Predictions rat pricing
NM_019221 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114978 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00326864 predicted 1032
2 SASI_Hs02_00326865 predicted 1166
3 SASI_Hs02_00326866 predicted 983
4 SASI_Hs02_00326867 predicted 960
5 SASI_Hs02_00326868 predicted 1026
6 SASI_Hs02_00326869 predicted 866
7 SASI_Hs02_00326870 predicted 987
8 SASI_Hs02_00326871 predicted 1115
9 SASI_Hs02_00326872 predicted 975
10 SASI_Hs02_00326873 predicted 830
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114979 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00326874 predicted 1032
2 SASI_Hs02_00326875 predicted 1170
3 SASI_Hs02_00326876 predicted 987
4 SASI_Hs02_00326877 predicted 965
5 SASI_Hs02_00326878 predicted 1029
6 SASI_Hs02_00326879 predicted 866
7 SASI_Hs02_00326880 predicted 982
8 SASI_Hs02_00326881 predicted 1114
9 SASI_Hs02_00326882 predicted 975
10 SASI_Hs02_00326883 predicted 835
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114980 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00326884 predicted 794
2 SASI_Hs02_00326885 predicted 937
3 SASI_Hs02_00326886 predicted 757
4 SASI_Hs02_00326887 predicted 732
5 SASI_Hs02_00326888 predicted 801
6 SASI_Hs02_00326889 predicted 638
7 SASI_Hs02_00326890 predicted 749
8 SASI_Hs02_00326891 predicted 889
9 SASI_Hs02_00326892 predicted 739
10 SASI_Hs02_00326893 predicted 599
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114981 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00326894 predicted 801
2 SASI_Hs02_00326895 predicted 939
3 SASI_Hs02_00326896 predicted 758
4 SASI_Hs02_00326897 predicted 738
5 SASI_Hs02_00326898 predicted 795
6 SASI_Hs02_00326899 predicted 638
7 SASI_Hs02_00326900 predicted 755
8 SASI_Hs02_00326901 predicted 889
9 SASI_Hs02_00326902 predicted 745
10 SASI_Hs02_00326903 predicted 603
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114982 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00326904 predicted 801
2 SASI_Hs02_00326905 predicted 938
3 SASI_Hs02_00326906 predicted 756
4 SASI_Hs02_00326907 predicted 735
5 SASI_Hs02_00326908 predicted 799
6 SASI_Hs02_00326909 predicted 635
7 SASI_Hs02_00326910 predicted 753
8 SASI_Hs02_00326911 predicted 888
9 SASI_Hs02_00326912 predicted 740
10 SASI_Hs02_00326913 predicted 602
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003722 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00246771 predicted 1031
2 SASI_Hs02_00336155 predicted 1168
3 SASI_Hs01_00246774 predicted 982
4 SASI_Hs02_00336156 predicted 961
5 SASI_Hs01_00246775 predicted 1026
6 SASI_Hs01_00246777 predicted 867
7 SASI_Hs02_00336157 predicted 983
8 SASI_Hs02_00336158 predicted 1120
9 SASI_Hs02_00336159 predicted 966
10 SASI_Hs02_00336160 predicted 835
11 SASI_Hs01_00246772 predicted 309
12 SASI_Hs01_00246773 predicted 291
13 SASI_Hs01_00246776 predicted 1244
14 SASI_Hs01_00246778 predicted 1834
15 SASI_Hs01_00246779 predicted 329
16 SASI_Hs01_00246780 predicted 1815
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127339 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00253633 predicted 1081
2 SASI_Rn02_00253634 predicted 927
3 SASI_Rn02_00253635 predicted 1016
4 SASI_Rn02_00253636 predicted 946
5 SASI_Rn02_00253637 predicted 1027
6 SASI_Rn02_00253638 predicted 714
7 SASI_Rn02_00253639 predicted 739
8 SASI_Rn02_00253640 predicted 730
9 SASI_Rn02_00253641 predicted 1037
10 SASI_Rn02_00253642 predicted 1045
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127341 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00253643 predicted 1084
2 SASI_Rn02_00253644 predicted 923
3 SASI_Rn02_00253645 predicted 1017
4 SASI_Rn02_00253646 predicted 948
5 SASI_Rn02_00253647 predicted 1026
6 SASI_Rn02_00253648 predicted 720
7 SASI_Rn02_00253649 predicted 740
8 SASI_Rn02_00253650 predicted 731
9 SASI_Rn02_00253651 predicted 1039
10 SASI_Rn02_00253652 predicted 1043
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127342 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00253653 predicted 659
2 SASI_Rn02_00253654 predicted 490
3 SASI_Rn02_00253655 predicted 586
4 SASI_Rn02_00253656 predicted 521
5 SASI_Rn02_00253657 predicted 603
6 SASI_Rn02_00253658 predicted 283
7 SASI_Rn02_00253659 predicted 305
8 SASI_Rn02_00253660 predicted 303
9 SASI_Rn02_00253661 predicted 611
10 SASI_Rn02_00253662 predicted 615
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127343 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00253663 predicted 660
2 SASI_Rn02_00253664 predicted 494
3 SASI_Rn02_00253665 predicted 587
4 SASI_Rn02_00253666 predicted 520
5 SASI_Rn02_00253667 predicted 600
6 SASI_Rn02_00253668 predicted 285
7 SASI_Rn02_00253669 predicted 313
8 SASI_Rn02_00253670 predicted 304
9 SASI_Rn02_00253671 predicted 613
10 SASI_Rn02_00253672 predicted 611
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127344 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00253673 predicted 659
2 SASI_Rn02_00253674 predicted 491
3 SASI_Rn02_00253675 predicted 593
4 SASI_Rn02_00253676 predicted 518
5 SASI_Rn02_00253677 predicted 603
6 SASI_Rn02_00253678 predicted 290
7 SASI_Rn02_00253679 predicted 313
8 SASI_Rn02_00253680 predicted 300
9 SASI_Rn02_00253681 predicted 611
10 SASI_Rn02_00253682 predicted 610
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019221 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00106050 predicted 1087
2 SASI_Rn02_00262074 predicted 928
3 SASI_Rn02_00262075 predicted 1022
4 SASI_Rn02_00262076 predicted 943
5 SASI_Rn02_00262077 predicted 1026
6 SASI_Rn02_00262078 predicted 713
7 SASI_Rn01_00106057 predicted 743
8 SASI_Rn02_00262079 predicted 724
9 SASI_Rn01_00106058 predicted 1042
10 SASI_Rn02_00262080 predicted 1047
11 SASI_Rn01_00106051 predicted 285
12 SASI_Rn01_00106052 predicted 722
13 SASI_Rn01_00106053 predicted 250
14 SASI_Rn01_00106054 predicted 1875
15 SASI_Rn01_00106055 predicted 927
16 SASI_Rn01_00106056 predicted 422
17 SASI_Rn01_00106059 predicted 1788
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003722
TP63 MISSION shRNA Bacterial Glycerol Stock
tumor protein p63
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000006502    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003722.3-2716s1c1
Sequence:CCGGGCCACATCAAACCTTTGAGTACTCGAGTACTCAAAGGTTTGATGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003722.3-870s1c1
Sequence:CCGGCCTAGTCATTTGATTCGAGTACTCGAGTACTCGAATCAAATGACTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003722.3-1218s1c1
Sequence:CCGGCCGTTTCGTCAGAACACACATCTCGAGATGTGTGTTCTGACGAAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003722.3-164s1c1
Sequence:CCGGCCCAGCTCATTTCTCTTGGAACTCGAGTTCCAAGAGAAATGAGCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003722.3-2058s1c1
Sequence:CCGGGAGTGGAATGACTTCAACTTTCTCGAGAAAGTTGAAGTCATTCCACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431014    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003722.4-2552s21c1
Sequence:CCGGAGTTGCACTTATTGACCATTTCTCGAGAAATGGTCAATAAGTGCAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420642    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003722.4-2286s21c1
Sequence:CCGGCATCTGACCTGGCATCTAATTCTCGAGAATTAGATGCCAGGTCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003722
TP63 MISSION shRNA shRNA Plasmid DNA
tumor protein p63
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000006502    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003722.3-2716s1c1
Sequence:CCGGGCCACATCAAACCTTTGAGTACTCGAGTACTCAAAGGTTTGATGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003722.3-870s1c1
Sequence:CCGGCCTAGTCATTTGATTCGAGTACTCGAGTACTCGAATCAAATGACTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003722.3-1218s1c1
Sequence:CCGGCCGTTTCGTCAGAACACACATCTCGAGATGTGTGTTCTGACGAAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003722.3-164s1c1
Sequence:CCGGCCCAGCTCATTTCTCTTGGAACTCGAGTTCCAAGAGAAATGAGCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003722.3-2058s1c1
Sequence:CCGGGAGTGGAATGACTTCAACTTTCTCGAGAAAGTTGAAGTCATTCCACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431014    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003722.4-2552s21c1
Sequence:CCGGAGTTGCACTTATTGACCATTTCTCGAGAAATGGTCAATAAGTGCAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420642    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003722.4-2286s21c1
Sequence:CCGGCATCTGACCTGGCATCTAATTCTCGAGAATTAGATGCCAGGTCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003722
TP63 MISSION shRNA Lentiviral Transduction Particles
tumor protein p63
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000006502    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003722.3-2716s1c1
Sequence:CCGGGCCACATCAAACCTTTGAGTACTCGAGTACTCAAAGGTTTGATGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003722.3-870s1c1
Sequence:CCGGCCTAGTCATTTGATTCGAGTACTCGAGTACTCGAATCAAATGACTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003722.3-1218s1c1
Sequence:CCGGCCGTTTCGTCAGAACACACATCTCGAGATGTGTGTTCTGACGAAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003722.3-164s1c1
Sequence:CCGGCCCAGCTCATTTCTCTTGGAACTCGAGTTCCAAGAGAAATGAGCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003722.3-2058s1c1
Sequence:CCGGGAGTGGAATGACTTCAACTTTCTCGAGAAAGTTGAAGTCATTCCACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431014    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003722.4-2552s21c1
Sequence:CCGGAGTTGCACTTATTGACCATTTCTCGAGAAATGGTCAATAAGTGCAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420642    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003722.4-2286s21c1
Sequence:CCGGCATCTGACCTGGCATCTAATTCTCGAGAATTAGATGCCAGGTCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks