EMAIL THIS PAGE TO A FRIEND

TP73-AS1

TP73 antisense RNA 1

Synonyms: KIAA0495 PDAM
Species: Human TP73-AS1(57212)
UniProtKB ID: Q9UF72
Gene ID:
39 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207306 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207306 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207306 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207306 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207306 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00119166 predicted 1468
2 SASI_Hs01_00119167 predicted 2153
3 SASI_Hs01_00119168 predicted 1640
4 SASI_Hs01_00119169 predicted 2178
5 SASI_Hs01_00119170 predicted 1634
6 SASI_Hs01_00119171 predicted 1948
7 SASI_Hs02_00373829 predicted 1276
8 SASI_Hs01_00119172 predicted 2165
9 SASI_Hs01_00119173 predicted 1633
10 SASI_Hs01_00119174 predicted 2152
11 SASI_Hs01_00119175 predicted 1035
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207306
VALIDATED
TP73-AS1 MISSION shRNA Bacterial Glycerol Stock
TP73 antisense RNA 1
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166821    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207306.1-1567s1c1
Sequence:CCGGCCTGGTAGATTGTGTGGGTTACTCGAGTAACCCACACAATCTACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163966    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207306.1-697s1c1
Sequence:CCGGCAAGTAAAGATACCAGCAGTGCTCGAGCACTGCTGGTATCTTTACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163810    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207306.1-3149s1c1
Sequence:CCGGGCGGTGTAAATTGACTCAGAACTCGAGTTCTGAGTCAATTTACACCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_207306.1-684s1c1
Sequence:CCGGGTTTCCTGCTTTCCAAGTAAACTCGAGTTTACTTGGAAAGCAGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161954    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207306.1-691s1c1
Sequence:CCGGGCTTTCCAAGTAAAGATACCACTCGAGTGGTATCTTTACTTGGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162409    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_207306.1-3150s1c1
Sequence:CCGGCGGTGTAAATTGACTCAGAAACTCGAGTTTCTGAGTCAATTTACACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164072    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207306.1-696s1c1
Sequence:CCGGCCAAGTAAAGATACCAGCAGTCTCGAGACTGCTGGTATCTTTACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000441751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207306.2-1693s21c1
Sequence:CCGGAGACATTGTCCTCAACGACCACTCGAGTGGTCGTTGAGGACAATGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372681    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207306.2-2218s21c1
Sequence:CCGGGGTCATCAGCCAGGTTGATTGCTCGAGCAATCAACCTGGCTGATGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372680    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207306.2-2160s21c1
Sequence:CCGGTTGATTGTGCGGGTTAGATAGCTCGAGCTATCTAACCCGCACAATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207306.2-1713s21c1
Sequence:CCGGAGCGGCACTTTGATCCGGTTTCTCGAGAAACCGGATCAAAGTGCCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207306.2-1650s21c1
Sequence:CCGGTGAGCATTTGGGCCAACACCACTCGAGTGGTGTTGGCCCAAATGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207306.2-1638s21c1
Sequence:CCGGAGCCTTCAGAGCTGAGCATTTCTCGAGAAATGCTCAGCTCTGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207306.2-1211s21c1
Sequence:CCGGAGCCTCAGCTCATTCTCTCAGCTCGAGCTGAGAGAATGAGCTGAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207306.2-1670s21c1
Sequence:CCGGAGAGTGGTTCGGGAACAGGATCTCGAGATCCTGTTCCCGAACCACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207306
VALIDATED
TP73-AS1 MISSION shRNA shRNA Plasmid DNA
TP73 antisense RNA 1
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166821    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207306.1-1567s1c1
Sequence:CCGGCCTGGTAGATTGTGTGGGTTACTCGAGTAACCCACACAATCTACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163966    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207306.1-697s1c1
Sequence:CCGGCAAGTAAAGATACCAGCAGTGCTCGAGCACTGCTGGTATCTTTACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163810    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207306.1-3149s1c1
Sequence:CCGGGCGGTGTAAATTGACTCAGAACTCGAGTTCTGAGTCAATTTACACCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_207306.1-684s1c1
Sequence:CCGGGTTTCCTGCTTTCCAAGTAAACTCGAGTTTACTTGGAAAGCAGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161954    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207306.1-691s1c1
Sequence:CCGGGCTTTCCAAGTAAAGATACCACTCGAGTGGTATCTTTACTTGGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162409    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_207306.1-3150s1c1
Sequence:CCGGCGGTGTAAATTGACTCAGAAACTCGAGTTTCTGAGTCAATTTACACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164072    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207306.1-696s1c1
Sequence:CCGGCCAAGTAAAGATACCAGCAGTCTCGAGACTGCTGGTATCTTTACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000441751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207306.2-1693s21c1
Sequence:CCGGAGACATTGTCCTCAACGACCACTCGAGTGGTCGTTGAGGACAATGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372681    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207306.2-2218s21c1
Sequence:CCGGGGTCATCAGCCAGGTTGATTGCTCGAGCAATCAACCTGGCTGATGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372680    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207306.2-2160s21c1
Sequence:CCGGTTGATTGTGCGGGTTAGATAGCTCGAGCTATCTAACCCGCACAATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207306.2-1713s21c1
Sequence:CCGGAGCGGCACTTTGATCCGGTTTCTCGAGAAACCGGATCAAAGTGCCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207306.2-1650s21c1
Sequence:CCGGTGAGCATTTGGGCCAACACCACTCGAGTGGTGTTGGCCCAAATGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207306.2-1638s21c1
Sequence:CCGGAGCCTTCAGAGCTGAGCATTTCTCGAGAAATGCTCAGCTCTGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207306.2-1211s21c1
Sequence:CCGGAGCCTCAGCTCATTCTCTCAGCTCGAGCTGAGAGAATGAGCTGAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207306.2-1670s21c1
Sequence:CCGGAGAGTGGTTCGGGAACAGGATCTCGAGATCCTGTTCCCGAACCACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207306
VALIDATED
TP73-AS1 MISSION shRNA Lentiviral Transduction Particles
TP73 antisense RNA 1
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166821    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207306.1-1567s1c1
Sequence:CCGGCCTGGTAGATTGTGTGGGTTACTCGAGTAACCCACACAATCTACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163966    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207306.1-697s1c1
Sequence:CCGGCAAGTAAAGATACCAGCAGTGCTCGAGCACTGCTGGTATCTTTACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163810    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207306.1-3149s1c1
Sequence:CCGGGCGGTGTAAATTGACTCAGAACTCGAGTTCTGAGTCAATTTACACCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_207306.1-684s1c1
Sequence:CCGGGTTTCCTGCTTTCCAAGTAAACTCGAGTTTACTTGGAAAGCAGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161954    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207306.1-691s1c1
Sequence:CCGGGCTTTCCAAGTAAAGATACCACTCGAGTGGTATCTTTACTTGGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162409    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_207306.1-3150s1c1
Sequence:CCGGCGGTGTAAATTGACTCAGAAACTCGAGTTTCTGAGTCAATTTACACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164072    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207306.1-696s1c1
Sequence:CCGGCCAAGTAAAGATACCAGCAGTCTCGAGACTGCTGGTATCTTTACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000441751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207306.2-1693s21c1
Sequence:CCGGAGACATTGTCCTCAACGACCACTCGAGTGGTCGTTGAGGACAATGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372681    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207306.2-2218s21c1
Sequence:CCGGGGTCATCAGCCAGGTTGATTGCTCGAGCAATCAACCTGGCTGATGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372680    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207306.2-2160s21c1
Sequence:CCGGTTGATTGTGCGGGTTAGATAGCTCGAGCTATCTAACCCGCACAATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207306.2-1713s21c1
Sequence:CCGGAGCGGCACTTTGATCCGGTTTCTCGAGAAACCGGATCAAAGTGCCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207306.2-1650s21c1
Sequence:CCGGTGAGCATTTGGGCCAACACCACTCGAGTGGTGTTGGCCCAAATGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207306.2-1638s21c1
Sequence:CCGGAGCCTTCAGAGCTGAGCATTTCTCGAGAAATGCTCAGCTCTGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207306.2-1211s21c1
Sequence:CCGGAGCCTCAGCTCATTCTCTCAGCTCGAGCTGAGAGAATGAGCTGAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207306.2-1670s21c1
Sequence:CCGGAGAGTGGTTCGGGAACAGGATCTCGAGATCCTGTTCCCGAACCACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks