EMAIL THIS PAGE TO A FRIEND

TP73

tumor protein p73

Synonyms: P73
Gene ID:
Human(7161) Summary: This gene encodes a member of the p53 family of transcription factors involved in cellular responses to stress and development. It maps to a region on chromosome 1p36 that is frequently deleted in neuroblastoma and other tumors, and thought to contain multiple tumor suppressor genes. The demonstration that this gene is monoallelically expressed (likely from the maternal allele), supports the notion that it is a candidate gene for neuroblastoma. Many transcript variants resulting from alternative splicing and/or use of alternate promoters have been found for this gene, but the biological validity and the full-length nature of some variants have not been determined. [provided by RefSeq, Feb 2011]
Rat(362675) tumor protein p73
Zebrafish(368221) tumor protein p73
Horse(100052597) tumor protein p73
domestic cat(101088009) tumor protein p73
dog(489620) tumor protein p73
chicken(419382) tumor protein p73
naked mole-rat(101716466) tumor protein p73
domestic guinea pig(100713659) tumor protein p73
sheep(101118974) tumor protein p73
120 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4503025 Anti-P73 antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
SAB4503024 Anti-P73, N-Terminal antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, western blot pricing
SAB4504510 Anti-phospho-p73 (pTyr99) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB4300046 Anti-phospho-TP73 (pTyr99) antibody produced in rabbit affinity isolated antibody human, rat, mouse
western blot pricing
SAB4300354 Anti-TP73 (Ab-99) antibody produced in rabbit affinity isolated antibody human
western blot pricing
AV38621 Anti-TP73 antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB2102518 Anti-TP73 antibody produced in rabbit affinity isolated antibody rat, human, zebrafish, mouse, guinea pig
western blot pricing
SAB2104358 Anti-TP73 antibody produced in rabbit affinity isolated antibody horse, human, guinea pig, zebrafish, rat, mouse
western blot pricing
SAB2104371 Anti-TP73 antibody produced in rabbit affinity isolated antibody human, guinea pig, mouse, rat, horse
western blot pricing
HPA027314 Anti-TP73 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, western blot pricing
HPA044516 Anti-TP73 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, western blot pricing
P3117 Monoclonal Anti-p73α antibody produced in mouse ~1 mg/mL, clone ER-13, purified immunoglobulin, buffered aqueous solution human, monkey
immunofluorescence, immunoprecipitation, western blot pricing
PLA0040 Rabbit anti-p73 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. rhesus monkey, human, chimpanzee, gorilla, African green monkey, primate
immunoprecipitation, proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005427 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005427 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005427 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU140741 MISSION® esiRNA esiRNA human TP73 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001126240 Rosetta Predictions human pricing
NM_001126241 Rosetta Predictions human pricing
NM_001126242 Rosetta Predictions human pricing
NM_005427 Rosetta Predictions human pricing
NM_001108696 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126240 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00328367 predicted 520
2 SASI_Hs02_00328368 predicted 2387
3 SASI_Hs02_00328369 predicted 828
4 SASI_Hs02_00328370 predicted 635
5 SASI_Hs02_00328371 predicted 1947
6 SASI_Hs02_00328372 predicted 2166
7 SASI_Hs02_00328373 predicted 738
8 SASI_Hs02_00328374 predicted 724
9 SASI_Hs02_00328375 predicted 966
10 SASI_Hs02_00328376 predicted 2185
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126241 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00328377 predicted 520
2 SASI_Hs02_00328378 predicted 827
3 SASI_Hs02_00328379 predicted 638
4 SASI_Hs02_00328380 predicted 1850
5 SASI_Hs02_00328381 predicted 2068
6 SASI_Hs02_00328382 predicted 738
7 SASI_Hs02_00328383 predicted 725
8 SASI_Hs02_00328384 predicted 965
9 SASI_Hs02_00328385 predicted 834
10 SASI_Hs02_00328386 predicted 608
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126242 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00328387 predicted 521
2 SASI_Hs02_00328388 predicted 827
3 SASI_Hs02_00328389 predicted 633
4 SASI_Hs02_00328390 predicted 1795
5 SASI_Hs02_00328391 predicted 737
6 SASI_Hs02_00328392 predicted 725
7 SASI_Hs02_00328393 predicted 972
8 SASI_Hs02_00328394 predicted 839
9 SASI_Hs02_00328395 predicted 614
10 SASI_Hs02_00328396 predicted 1186
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005427 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00339572 predicted 546
2 SASI_Hs02_00339573 predicted 2411
3 SASI_Hs02_00339574 predicted 853
4 SASI_Hs01_00045130 predicted 658
5 SASI_Hs01_00045131 predicted 1967
6 SASI_Hs02_00339575 predicted 2191
7 SASI_Hs02_00339576 predicted 764
8 SASI_Hs01_00045133 predicted 749
9 SASI_Hs01_00045134 predicted 995
10 SASI_Hs02_00339577 predicted 2213
11 SASI_Hs01_00045129 predicted 1655
12 SASI_Hs01_00045132 predicted 242
13 SASI_Hs01_00045135 predicted 1213
14 SASI_Hs01_00045136 predicted 1504
15 SASI_Hs01_00045137 predicted 278
16 SASI_Hs01_00045138 predicted 284
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108696 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00241175 predicted 785
2 SASI_Rn02_00241176 predicted 2120
3 SASI_Rn02_00241177 predicted 1664
4 SASI_Rn02_00241178 predicted 1224
5 SASI_Rn02_00241179 predicted 688
6 SASI_Rn02_00241180 predicted 2091
7 SASI_Rn02_00241181 predicted 579
8 SASI_Rn02_00241182 predicted 1534
9 SASI_Rn02_00241183 predicted 803
10 SASI_Rn02_00241184 predicted 769
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005427
VALIDATED
TP73 MISSION shRNA Bacterial Glycerol Stock
tumor protein p73
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000284787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005427.2-289s21c1
Sequence:CCGGCTGTCATGGCCCAGTTCAATCCTCGAGGATTGAACTGGGCCATGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005427.2-545s21c1
Sequence:CCGGCCCGCTCTTGAAGAAACTCTACTCGAGTAGAGTTTCTTCAAGAGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005427.2-753s21c1
Sequence:CCGGATCCGCGTGGAAGGCAATAATCTCGAGATTATTGCCTTCCACGCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272527    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005427.2-2076s21c1
Sequence:CCGGCTCTCCTTCCTGTGTGTCCAACTCGAGTTGGACACACAGGAAGGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005427.2-1643s21c1
Sequence:CCGGCCAAGGGTTACAGAGCATTTACTCGAGTAAATGCTCTGTAACCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005427.1-1613s1c1
Sequence:CCGGGTGTCCAAACTGCATCGAGTACTCGAGTACTCGATGCAGTTTGGACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005427.1-1643s1c1
Sequence:CCGGCCAAGGGTTACAGAGCATTTACTCGAGTAAATGCTCTGTAACCCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005427.1-545s1c1
Sequence:CCGGCCCGCTCTTGAAGAAACTCTACTCGAGTAGAGTTTCTTCAAGAGCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006507    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005427.1-2076s1c1
Sequence:CCGGCTCTCCTTCCTGTGTGTCCAACTCGAGTTGGACACACAGGAAGGAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005427.1-481s1c1
Sequence:CCGGCCCACCACTTTGAGGTCACTTCTCGAGAAGTGACCTCAAAGTGGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005427
VALIDATED
TP73 MISSION shRNA shRNA Plasmid DNA
tumor protein p73
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000284787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005427.2-289s21c1
Sequence:CCGGCTGTCATGGCCCAGTTCAATCCTCGAGGATTGAACTGGGCCATGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005427.2-545s21c1
Sequence:CCGGCCCGCTCTTGAAGAAACTCTACTCGAGTAGAGTTTCTTCAAGAGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005427.2-753s21c1
Sequence:CCGGATCCGCGTGGAAGGCAATAATCTCGAGATTATTGCCTTCCACGCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272527    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005427.2-2076s21c1
Sequence:CCGGCTCTCCTTCCTGTGTGTCCAACTCGAGTTGGACACACAGGAAGGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005427.2-1643s21c1
Sequence:CCGGCCAAGGGTTACAGAGCATTTACTCGAGTAAATGCTCTGTAACCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005427.1-1613s1c1
Sequence:CCGGGTGTCCAAACTGCATCGAGTACTCGAGTACTCGATGCAGTTTGGACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005427.1-1643s1c1
Sequence:CCGGCCAAGGGTTACAGAGCATTTACTCGAGTAAATGCTCTGTAACCCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005427.1-545s1c1
Sequence:CCGGCCCGCTCTTGAAGAAACTCTACTCGAGTAGAGTTTCTTCAAGAGCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006507    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005427.1-2076s1c1
Sequence:CCGGCTCTCCTTCCTGTGTGTCCAACTCGAGTTGGACACACAGGAAGGAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005427.1-481s1c1
Sequence:CCGGCCCACCACTTTGAGGTCACTTCTCGAGAAGTGACCTCAAAGTGGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005427
VALIDATED
TP73 MISSION shRNA Lentiviral Transduction Particles
tumor protein p73
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000284787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005427.2-289s21c1
Sequence:CCGGCTGTCATGGCCCAGTTCAATCCTCGAGGATTGAACTGGGCCATGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005427.2-545s21c1
Sequence:CCGGCCCGCTCTTGAAGAAACTCTACTCGAGTAGAGTTTCTTCAAGAGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005427.2-753s21c1
Sequence:CCGGATCCGCGTGGAAGGCAATAATCTCGAGATTATTGCCTTCCACGCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272527    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005427.2-2076s21c1
Sequence:CCGGCTCTCCTTCCTGTGTGTCCAACTCGAGTTGGACACACAGGAAGGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005427.2-1643s21c1
Sequence:CCGGCCAAGGGTTACAGAGCATTTACTCGAGTAAATGCTCTGTAACCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005427.1-1613s1c1
Sequence:CCGGGTGTCCAAACTGCATCGAGTACTCGAGTACTCGATGCAGTTTGGACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005427.1-1643s1c1
Sequence:CCGGCCAAGGGTTACAGAGCATTTACTCGAGTAAATGCTCTGTAACCCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005427.1-545s1c1
Sequence:CCGGCCCGCTCTTGAAGAAACTCTACTCGAGTAGAGTTTCTTCAAGAGCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006507    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005427.1-2076s1c1
Sequence:CCGGCTCTCCTTCCTGTGTGTCCAACTCGAGTTGGACACACAGGAAGGAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005427.1-481s1c1
Sequence:CCGGCCCACCACTTTGAGGTCACTTCTCGAGAAGTGACCTCAAAGTGGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks