EMAIL THIS PAGE TO A FRIEND

TPBG

trophoblast glycoprotein

Synonyms: 5T4 5T4AG M6P1
UniProtKB ID: Q13641
Gene ID:
Human(7162) Summary: This gene encodes a leucine-rich transmembrane glycoprotein that may be involved in cell adhesion. The encoded protein is an oncofetal antigen that is specific to trophoblast cells. In adults this protein is highly expressed in many tumor cells and is associated with poor clinical outcome in numerous cancers. Alternate splicing in the 5' UTR results in multiple transcript variants that encode the same protein. [provided by RefSeq, Oct 2009]
Mouse(21983) trophoblast glycoprotein
Rat(83684) trophoblast glycoprotein
chicken(772098) trophoblast glycoprotein
dog(481899) trophoblast glycoprotein
domestic cat(101085466) trophoblast glycoprotein
cow(540358) trophoblast glycoprotein
sheep(101121101) trophoblast glycoprotein
domestic guinea pig(100727328) trophoblast glycoprotein
naked mole-rat(101720499) trophoblast glycoprotein
90 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1241 Human 5T4 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006670 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006670 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006670 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011627 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011627 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011627 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU053631 MISSION® esiRNA esiRNA human TPBG (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006670 Rosetta Predictions human pricing
NM_031807 Rosetta Predictions rat pricing
NM_011627 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006670 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00029969 predicted 1718
2 SASI_Hs01_00029970 predicted 1483
3 SASI_Hs01_00029971 predicted 1868
4 SASI_Hs01_00029972 predicted 1951
5 SASI_Hs01_00029973 predicted 1757
6 SASI_Hs01_00029975 predicted 1846
7 SASI_Hs02_00342071 predicted 1863
8 SASI_Hs01_00029976 predicted 1478
9 SASI_Hs01_00029977 predicted 1731
10 SASI_Hs01_00029978 predicted 1729
11 SASI_Hs01_00029974 predicted 2019
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031807 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00106437 predicted 1437
2 SASI_Rn01_00106438 predicted 877
3 SASI_Rn01_00106439 predicted 1315
4 SASI_Rn01_00106440 predicted 1312
5 SASI_Rn01_00106441 predicted 630
6 SASI_Rn01_00106442 predicted 888
7 SASI_Rn01_00106444 predicted 1445
8 SASI_Rn02_00265263 predicted 1428
9 SASI_Rn01_00106445 predicted 922
10 SASI_Rn01_00106446 predicted 1059
11 SASI_Rn01_00106443 predicted 840
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011627 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00053122 predicted 1516
2 SASI_Mm02_00321072 predicted 1454
3 SASI_Mm01_00053124 predicted 781
4 SASI_Mm01_00053125 predicted 1167
5 SASI_Mm01_00053126 predicted 1584
6 SASI_Mm01_00053127 predicted 1039
7 SASI_Mm01_00053128 predicted 1509
8 SASI_Mm01_00053129 predicted 1146
9 SASI_Mm01_00053130 predicted 1222
10 SASI_Mm01_00053131 predicted 1520
11 SASI_Mm01_00053123 predicted 1598
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006670
VALIDATED
TPBG MISSION shRNA Bacterial Glycerol Stock
trophoblast glycoprotein
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006670.3-1190s21c1
Sequence:CCGGGCAACCTGACACATCTAGAAACTCGAGTTTCTAGATGTGTCAGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006670.3-1608s21c1
Sequence:CCGGTCACATGGAAGGGTATCATTACTCGAGTAATGATACCCTTCCATGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006670.3-1655s21c1
Sequence:CCGGGATTAACGAACCTCAGTTCTACTCGAGTAGAACTGAGGTTCGTTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338766    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006670.3-1726s21c1
Sequence:CCGGGAGATGTAGACTTAAGCTTTACTCGAGTAAAGCTTAAGTCTACATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006670.3-1513s21c1
Sequence:CCGGTTAGCCCTGATAGGCGCTATTCTCGAGAATAGCGCCTATCAGGGCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166532    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006670.3-1665s1c1
Sequence:CCGGCCTCAGTTCTAACTCGGATGTCTCGAGACATCCGAGTTAGAACTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006670.3-1655s1c1
Sequence:CCGGGATTAACGAACCTCAGTTCTACTCGAGTAGAACTGAGGTTCGTTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006670.3-1190s1c1
Sequence:CCGGGCAACCTGACACATCTAGAAACTCGAGTTTCTAGATGTGTCAGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163669    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006670.3-1606s1c1
Sequence:CCGGGATCACATGGAAGGGTATCATCTCGAGATGATACCCTTCCATGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164039    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006670.3-1652s1c1
Sequence:CCGGCCAGATTAACGAACCTCAGTTCTCGAGAACTGAGGTTCGTTAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166247    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006670.3-1478s1c1
Sequence:CCGGCCCTGCAAACCTCTTATGTCTCTCGAGAGACATAAGAGGTTTGCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006670
VALIDATED
TPBG MISSION shRNA shRNA Plasmid DNA
trophoblast glycoprotein
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006670.3-1190s21c1
Sequence:CCGGGCAACCTGACACATCTAGAAACTCGAGTTTCTAGATGTGTCAGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006670.3-1608s21c1
Sequence:CCGGTCACATGGAAGGGTATCATTACTCGAGTAATGATACCCTTCCATGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006670.3-1655s21c1
Sequence:CCGGGATTAACGAACCTCAGTTCTACTCGAGTAGAACTGAGGTTCGTTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338766    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006670.3-1726s21c1
Sequence:CCGGGAGATGTAGACTTAAGCTTTACTCGAGTAAAGCTTAAGTCTACATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006670.3-1513s21c1
Sequence:CCGGTTAGCCCTGATAGGCGCTATTCTCGAGAATAGCGCCTATCAGGGCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166532    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006670.3-1665s1c1
Sequence:CCGGCCTCAGTTCTAACTCGGATGTCTCGAGACATCCGAGTTAGAACTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006670.3-1655s1c1
Sequence:CCGGGATTAACGAACCTCAGTTCTACTCGAGTAGAACTGAGGTTCGTTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006670.3-1190s1c1
Sequence:CCGGGCAACCTGACACATCTAGAAACTCGAGTTTCTAGATGTGTCAGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163669    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006670.3-1606s1c1
Sequence:CCGGGATCACATGGAAGGGTATCATCTCGAGATGATACCCTTCCATGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164039    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006670.3-1652s1c1
Sequence:CCGGCCAGATTAACGAACCTCAGTTCTCGAGAACTGAGGTTCGTTAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166247    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006670.3-1478s1c1
Sequence:CCGGCCCTGCAAACCTCTTATGTCTCTCGAGAGACATAAGAGGTTTGCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006670
VALIDATED
TPBG MISSION shRNA Lentiviral Transduction Particles
trophoblast glycoprotein
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006670.3-1190s21c1
Sequence:CCGGGCAACCTGACACATCTAGAAACTCGAGTTTCTAGATGTGTCAGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006670.3-1608s21c1
Sequence:CCGGTCACATGGAAGGGTATCATTACTCGAGTAATGATACCCTTCCATGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006670.3-1655s21c1
Sequence:CCGGGATTAACGAACCTCAGTTCTACTCGAGTAGAACTGAGGTTCGTTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338766    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006670.3-1726s21c1
Sequence:CCGGGAGATGTAGACTTAAGCTTTACTCGAGTAAAGCTTAAGTCTACATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006670.3-1513s21c1
Sequence:CCGGTTAGCCCTGATAGGCGCTATTCTCGAGAATAGCGCCTATCAGGGCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166532    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006670.3-1665s1c1
Sequence:CCGGCCTCAGTTCTAACTCGGATGTCTCGAGACATCCGAGTTAGAACTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006670.3-1655s1c1
Sequence:CCGGGATTAACGAACCTCAGTTCTACTCGAGTAGAACTGAGGTTCGTTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006670.3-1190s1c1
Sequence:CCGGGCAACCTGACACATCTAGAAACTCGAGTTTCTAGATGTGTCAGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163669    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006670.3-1606s1c1
Sequence:CCGGGATCACATGGAAGGGTATCATCTCGAGATGATACCCTTCCATGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164039    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006670.3-1652s1c1
Sequence:CCGGCCAGATTAACGAACCTCAGTTCTCGAGAACTGAGGTTCGTTAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166247    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006670.3-1478s1c1
Sequence:CCGGCCCTGCAAACCTCTTATGTCTCTCGAGAGACATAAGAGGTTTGCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011627
TPBG MISSION shRNA Bacterial Glycerol Stock
trophoblast glycoprotein
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000176374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011627.2-1592s1c1
Sequence:CCGGCTTCCTATGTCTTCCTAGGTACTCGAGTACCTAGGAAGACATAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011627.2-1734s1c1
Sequence:CCGGCAGATACGAAATCAATGCGGACTCGAGTCCGCATTGATTTCGTATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011627.2-1653s1c1
Sequence:CCGGGTATTTGAACCGTAAAGGCATCTCGAGATGCCTTTACGGTTCAAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193433    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011627.2-1890s1c1
Sequence:CCGGGTAGACACTATTGACTTTGATCTCGAGATCAAAGTCAATAGTGTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011627
TPBG MISSION shRNA shRNA Plasmid DNA
trophoblast glycoprotein
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000176374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011627.2-1592s1c1
Sequence:CCGGCTTCCTATGTCTTCCTAGGTACTCGAGTACCTAGGAAGACATAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011627.2-1734s1c1
Sequence:CCGGCAGATACGAAATCAATGCGGACTCGAGTCCGCATTGATTTCGTATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011627.2-1653s1c1
Sequence:CCGGGTATTTGAACCGTAAAGGCATCTCGAGATGCCTTTACGGTTCAAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193433    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011627.2-1890s1c1
Sequence:CCGGGTAGACACTATTGACTTTGATCTCGAGATCAAAGTCAATAGTGTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011627
TPBG MISSION shRNA Lentiviral Transduction Particles
trophoblast glycoprotein
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000176374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011627.2-1592s1c1
Sequence:CCGGCTTCCTATGTCTTCCTAGGTACTCGAGTACCTAGGAAGACATAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011627.2-1734s1c1
Sequence:CCGGCAGATACGAAATCAATGCGGACTCGAGTCCGCATTGATTTCGTATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011627.2-1653s1c1
Sequence:CCGGGTATTTGAACCGTAAAGGCATCTCGAGATGCCTTTACGGTTCAAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193433    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011627.2-1890s1c1
Sequence:CCGGGTAGACACTATTGACTTTGATCTCGAGATCAAAGTCAATAGTGTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks