EMAIL THIS PAGE TO A FRIEND

TPCN1

two pore segment channel 1

Synonyms: TPC1
UniProtKB ID: Q9ULQ1, A7E258, Q86XS9, Q8NC20
Gene ID:
Human(53373) Summary: Voltage-gated Ca(2+) and Na+ channels have 4 homologous domains, each containing 6 transmembrane segments, S1 to S6. TPCN1 is similar to these channels, but it has only 2 domains containing S1 to S6 (Ishibashi et al., 2000 [PubMed 10753632]
Mouse(252972) two pore channel 1
Rat(246215) two pore segment channel 1
cow(510830) two pore segment channel 1
sheep(101113364) two pore segment channel 1
domestic guinea pig(100717872) two pore segment channel 1
naked mole-rat(101723791) two pore segment channel 1
Domestic Rabbit(100341301) two pore segment channel 1
Zebrafish(567534) two pore segment channel 1
Horse(100051154) two pore segment channel 1
domestic cat(101089398) two pore segment channel 1
dog(477492) two pore segment channel 1
chicken(417033) two pore segment channel 1
49 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA039757 Anti-TPCN1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB2104213 Anti-TPCN1, (N-terminal) antibody produced in rabbit affinity isolated antibody human, zebrafish, rabbit, mouse, guinea pig, canine, horse, rat
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145853 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145853 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145853 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017901 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017901 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017901 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU016301 MISSION® esiRNA esiRNA targeting human TPCN1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017901 Rosetta Predictions human pricing
NM_139332 Rosetta Predictions rat pricing
NM_145853 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017901 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00074643 predicted 1794
2 SASI_Hs01_00074644 predicted 1876
3 SASI_Hs01_00074645 predicted 591
4 SASI_Hs01_00074646 predicted 2324
5 SASI_Hs01_00074647 predicted 1498
6 SASI_Hs01_00074648 predicted 1430
7 SASI_Hs01_00074649 predicted 1117
8 SASI_Hs01_00074650 predicted 2210
9 SASI_Hs01_00074651 predicted 1711
10 SASI_Hs01_00074652 predicted 1574
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139332 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00107855 predicted 1765
2 SASI_Rn01_00107856 predicted 1678
3 SASI_Rn01_00107857 predicted 2788
4 SASI_Rn01_00107858 predicted 1160
5 SASI_Rn01_00107859 predicted 2763
6 SASI_Rn01_00107861 predicted 2157
7 SASI_Rn02_00268595 predicted 996
8 SASI_Rn01_00107862 predicted 2172
9 SASI_Rn01_00107863 predicted 1399
10 SASI_Rn01_00107864 predicted 439
11 SASI_Rn01_00107860 predicted 2088
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145853 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00128508 predicted 1672
2 SASI_Mm01_00128509 predicted 1641
3 SASI_Mm01_00128510 predicted 1768
4 SASI_Mm01_00128511 predicted 1233
5 SASI_Mm01_00128512 predicted 2175
6 SASI_Mm01_00128514 predicted 2747
7 SASI_Mm01_00128515 predicted 2140
8 SASI_Mm01_00128516 predicted 1434
9 SASI_Mm01_00128517 predicted 2122
10 SASI_Mm02_00341351 predicted 1818
11 SASI_Mm01_00128513 predicted 999
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145853
VALIDATED
TPCN1 MISSION shRNA Bacterial Glycerol Stock
two pore segment channel 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069993    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145853.2-2873s1c1
Sequence:CCGGGCTCCAGAAATAACCAGCTTACTCGAGTAAGCTGGTTATTTCTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145853.2-2239s1c1
Sequence:CCGGCGCCTGTACTTCATGACCTTTCTCGAGAAAGGTCATGAAGTACAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145853.2-1968s1c1
Sequence:CCGGGCTCACCTTCTACTATTCCTTCTCGAGAAGGAATAGTAGAAGGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145853.2-555s1c1
Sequence:CCGGCCACAACCACTTCTTCTACATCTCGAGATGTAGAAGAAGTGGTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145853.2-1335s1c1
Sequence:CCGGCGAAGGCTTAATGCGCTTCTACTCGAGTAGAAGCGCATTAAGCCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145853.2-1335s21c1
Sequence:CCGGCGAAGGCTTAATGCGCTTCTACTCGAGTAGAAGCGCATTAAGCCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145853.2-555s21c1
Sequence:CCGGCCACAACCACTTCTTCTACATCTCGAGATGTAGAAGAAGTGGTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145853.2-1968s21c1
Sequence:CCGGGCTCACCTTCTACTATTCCTTCTCGAGAAGGAATAGTAGAAGGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316943    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145853.2-2873s21c1
Sequence:CCGGGCTCCAGAAATAACCAGCTTACTCGAGTAAGCTGGTTATTTCTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145853
VALIDATED
TPCN1 MISSION shRNA shRNA Plasmid DNA
two pore segment channel 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069993    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145853.2-2873s1c1
Sequence:CCGGGCTCCAGAAATAACCAGCTTACTCGAGTAAGCTGGTTATTTCTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145853.2-2239s1c1
Sequence:CCGGCGCCTGTACTTCATGACCTTTCTCGAGAAAGGTCATGAAGTACAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145853.2-1968s1c1
Sequence:CCGGGCTCACCTTCTACTATTCCTTCTCGAGAAGGAATAGTAGAAGGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145853.2-555s1c1
Sequence:CCGGCCACAACCACTTCTTCTACATCTCGAGATGTAGAAGAAGTGGTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145853.2-1335s1c1
Sequence:CCGGCGAAGGCTTAATGCGCTTCTACTCGAGTAGAAGCGCATTAAGCCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145853.2-1335s21c1
Sequence:CCGGCGAAGGCTTAATGCGCTTCTACTCGAGTAGAAGCGCATTAAGCCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145853.2-555s21c1
Sequence:CCGGCCACAACCACTTCTTCTACATCTCGAGATGTAGAAGAAGTGGTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145853.2-1968s21c1
Sequence:CCGGGCTCACCTTCTACTATTCCTTCTCGAGAAGGAATAGTAGAAGGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316943    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145853.2-2873s21c1
Sequence:CCGGGCTCCAGAAATAACCAGCTTACTCGAGTAAGCTGGTTATTTCTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145853
VALIDATED
TPCN1 MISSION shRNA Lentiviral Transduction Particles
two pore segment channel 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069993    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145853.2-2873s1c1
Sequence:CCGGGCTCCAGAAATAACCAGCTTACTCGAGTAAGCTGGTTATTTCTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145853.2-2239s1c1
Sequence:CCGGCGCCTGTACTTCATGACCTTTCTCGAGAAAGGTCATGAAGTACAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145853.2-1968s1c1
Sequence:CCGGGCTCACCTTCTACTATTCCTTCTCGAGAAGGAATAGTAGAAGGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145853.2-555s1c1
Sequence:CCGGCCACAACCACTTCTTCTACATCTCGAGATGTAGAAGAAGTGGTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145853.2-1335s1c1
Sequence:CCGGCGAAGGCTTAATGCGCTTCTACTCGAGTAGAAGCGCATTAAGCCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145853.2-1335s21c1
Sequence:CCGGCGAAGGCTTAATGCGCTTCTACTCGAGTAGAAGCGCATTAAGCCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145853.2-555s21c1
Sequence:CCGGCCACAACCACTTCTTCTACATCTCGAGATGTAGAAGAAGTGGTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145853.2-1968s21c1
Sequence:CCGGGCTCACCTTCTACTATTCCTTCTCGAGAAGGAATAGTAGAAGGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316943    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145853.2-2873s21c1
Sequence:CCGGGCTCCAGAAATAACCAGCTTACTCGAGTAAGCTGGTTATTTCTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017901
VALIDATED
TPCN1 MISSION shRNA Bacterial Glycerol Stock
two pore segment channel 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000005040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017901.3-1802s1c1
Sequence:CCGGCGGATGGAACTTGTTTGACTTCTCGAGAAGTCAAACAAGTTCCATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_017901.3-2280s1c1
Sequence:CCGGCGCCTCTACTTCATGACCTTTCTCGAGAAAGGTCATGAAGTAGAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_017901.3-582s1c1
Sequence:CCGGGCCTACCTCTTTGCACACAATCTCGAGATTGTGTGCAAAGAGGTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_017901.3-1664s1c1
Sequence:CCGGCGTGGAGACATTTATGCTGAACTCGAGTTCAGCATAAATGTCTCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_017901.3-1916s1c1
Sequence:CCGGGCTGAGGTTGTTTAAGTTGAACTCGAGTTCAACTTAAACAACCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369111    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017901.4-2828s21c1
Sequence:CCGGGTACACATACTCACGTATATGCTCGAGCATATACGTGAGTATGTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_017901.4-2334s21c1
Sequence:CCGGGACGATCATTGTCGCCTTTATCTCGAGATAAAGGCGACAATGATCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_017901.4-1926s21c1
Sequence:CCGGGCTGAGGTTGTTTAAGTTGAACTCGAGTTCAACTTAAACAACCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_017901.4-1582s21c1
Sequence:CCGGCTCATCTTCAAAGGTATTAATCTCGAGATTAATACCTTTGAAGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_017901.4-592s21c1
Sequence:CCGGGCCTACCTCTTTGCACACAATCTCGAGATTGTGTGCAAAGAGGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017901
VALIDATED
TPCN1 MISSION shRNA shRNA Plasmid DNA
two pore segment channel 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000005040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017901.3-1802s1c1
Sequence:CCGGCGGATGGAACTTGTTTGACTTCTCGAGAAGTCAAACAAGTTCCATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_017901.3-2280s1c1
Sequence:CCGGCGCCTCTACTTCATGACCTTTCTCGAGAAAGGTCATGAAGTAGAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_017901.3-582s1c1
Sequence:CCGGGCCTACCTCTTTGCACACAATCTCGAGATTGTGTGCAAAGAGGTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_017901.3-1664s1c1
Sequence:CCGGCGTGGAGACATTTATGCTGAACTCGAGTTCAGCATAAATGTCTCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_017901.3-1916s1c1
Sequence:CCGGGCTGAGGTTGTTTAAGTTGAACTCGAGTTCAACTTAAACAACCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369111    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017901.4-2828s21c1
Sequence:CCGGGTACACATACTCACGTATATGCTCGAGCATATACGTGAGTATGTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_017901.4-2334s21c1
Sequence:CCGGGACGATCATTGTCGCCTTTATCTCGAGATAAAGGCGACAATGATCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_017901.4-1926s21c1
Sequence:CCGGGCTGAGGTTGTTTAAGTTGAACTCGAGTTCAACTTAAACAACCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_017901.4-1582s21c1
Sequence:CCGGCTCATCTTCAAAGGTATTAATCTCGAGATTAATACCTTTGAAGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_017901.4-592s21c1
Sequence:CCGGGCCTACCTCTTTGCACACAATCTCGAGATTGTGTGCAAAGAGGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017901
VALIDATED
TPCN1 MISSION shRNA Lentiviral Transduction Particles
two pore segment channel 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000005040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017901.3-1802s1c1
Sequence:CCGGCGGATGGAACTTGTTTGACTTCTCGAGAAGTCAAACAAGTTCCATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_017901.3-2280s1c1
Sequence:CCGGCGCCTCTACTTCATGACCTTTCTCGAGAAAGGTCATGAAGTAGAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_017901.3-582s1c1
Sequence:CCGGGCCTACCTCTTTGCACACAATCTCGAGATTGTGTGCAAAGAGGTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_017901.3-1664s1c1
Sequence:CCGGCGTGGAGACATTTATGCTGAACTCGAGTTCAGCATAAATGTCTCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_017901.3-1916s1c1
Sequence:CCGGGCTGAGGTTGTTTAAGTTGAACTCGAGTTCAACTTAAACAACCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369111    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017901.4-2828s21c1
Sequence:CCGGGTACACATACTCACGTATATGCTCGAGCATATACGTGAGTATGTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_017901.4-2334s21c1
Sequence:CCGGGACGATCATTGTCGCCTTTATCTCGAGATAAAGGCGACAATGATCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_017901.4-1926s21c1
Sequence:CCGGGCTGAGGTTGTTTAAGTTGAACTCGAGTTCAACTTAAACAACCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_017901.4-1582s21c1
Sequence:CCGGCTCATCTTCAAAGGTATTAATCTCGAGATTAATACCTTTGAAGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_017901.4-592s21c1
Sequence:CCGGGCCTACCTCTTTGCACACAATCTCGAGATTGTGTGCAAAGAGGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks