EMAIL THIS PAGE TO A FRIEND

TPCN2

two pore segment channel 2

Synonyms: SHEP10 TPC2
UniProtKB ID: Q8NHX9, Q9NT82
Gene ID:
Human(219931) Summary: This gene encodes a putative cation-selective ion channel with two repeats of a six-transmembrane-domain. The protein localizes to lysosomal membranes and enables nicotinic acid adenine dinucleotide phosphate (NAADP) -induced calcium ion release from lysosome-related stores. This ubiquitously expressed gene has elevated expression in liver and kidney. Two common nonsynonymous SNPs in this gene strongly associate with blond versus brown hair pigmentation.[provided by RefSeq, Dec 2009]
Mouse(233979) two pore segment channel 2
Rat(309139) two pore segment channel 2
Zebrafish(777614) two pore segment channel 2
chicken(423141) two pore segment channel 2
dog(483683) two pore segment channel 2
domestic cat(101086345) two pore segment channel 2
naked mole-rat(101712986) two pore segment channel 2
domestic guinea pig(100729259) two pore segment channel 2
cow(516679) two pore segment channel 2
sheep(101115493) two pore segment channel 2
56 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_139075 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_139075 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_139075 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_146206 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146206 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146206 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_139075 Rosetta Predictions human pricing
NM_001107566 Rosetta Predictions rat pricing
NM_146206 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139075 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00129376 predicted 1733
2 SASI_Hs01_00129377 predicted 1882
3 SASI_Hs01_00129378 predicted 1616
4 SASI_Hs01_00129379 predicted 511
5 SASI_Hs01_00129381 predicted 1069
6 SASI_Hs01_00129383 predicted 2063
7 SASI_Hs01_00129385 predicted 2153
8 SASI_Hs02_00364130 predicted 336
9 SASI_Hs02_00364131 predicted 2047
10 SASI_Hs02_00364132 predicted 1790
11 SASI_Hs01_00129380 predicted 1305
12 SASI_Hs01_00129382 predicted 1259
13 SASI_Hs01_00129384 predicted 1247
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107566 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00230095 predicted 961
2 SASI_Rn02_00230096 predicted 2094
3 SASI_Rn02_00230097 predicted 1852
4 SASI_Rn02_00230098 predicted 1765
5 SASI_Rn02_00230099 predicted 1146
6 SASI_Rn02_00230100 predicted 2184
7 SASI_Rn02_00230101 predicted 1995
8 SASI_Rn02_00230102 predicted 1039
9 SASI_Rn02_00230103 predicted 656
10 SASI_Rn02_00230104 predicted 607
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146206 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00164161 predicted 2175
2 SASI_Mm01_00164162 predicted 2007
3 SASI_Mm01_00164163 predicted 1804
4 SASI_Mm01_00164164 predicted 840
5 SASI_Mm01_00164165 predicted 2120
6 SASI_Mm01_00164166 predicted 1591
7 SASI_Mm01_00164167 predicted 1867
8 SASI_Mm01_00164168 predicted 585
9 SASI_Mm01_00164169 predicted 1739
10 SASI_Mm01_00164170 predicted 659
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139075
VALIDATED
TPCN2 MISSION shRNA Bacterial Glycerol Stock
two pore segment channel 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139075.3-1361s21c1
Sequence:CCGGCGAGTACCAGTCTCCGTTTCTCTCGAGAGAAACGGAGACTGGTACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139075.3-2083s21c1
Sequence:CCGGAGGTGTTTCTGGATGCATATCCTCGAGGATATGCATCCAGAAACACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139075.3-267s21c1
Sequence:CCGGGTCTTCATCGAAGATGCTATTCTCGAGAATAGCATCTTCGATGAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139075.3-1843s21c1
Sequence:CCGGTGCAGAACATGCGTGCGTTTGCTCGAGCAAACGCACGCATGTTCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139075.1-926s1c1
Sequence:CCGGCGATGTGATGATTCCTGCGTACTCGAGTACGCAGGAATCATCACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_139075.1-324s1c1
Sequence:CCGGCGACGGTATTACTCGAACGTACTCGAGTACGTTCGAGTAATACCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_139075.1-1307s1c1
Sequence:CCGGGCTTGACAGAAGTGTGGTTAACTCGAGTTAACCACACTTCTGTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_139075.1-1739s1c1
Sequence:CCGGGCTGAACATGCTCATCGTGTTCTCGAGAACACGATGAGCATGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_139075.1-2102s1c1
Sequence:CCGGCCCGTGGTCCAAGATCTATTTCTCGAGAAATAGATCTTGGACCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139075
VALIDATED
TPCN2 MISSION shRNA shRNA Plasmid DNA
two pore segment channel 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139075.3-1361s21c1
Sequence:CCGGCGAGTACCAGTCTCCGTTTCTCTCGAGAGAAACGGAGACTGGTACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139075.3-2083s21c1
Sequence:CCGGAGGTGTTTCTGGATGCATATCCTCGAGGATATGCATCCAGAAACACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139075.3-267s21c1
Sequence:CCGGGTCTTCATCGAAGATGCTATTCTCGAGAATAGCATCTTCGATGAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139075.3-1843s21c1
Sequence:CCGGTGCAGAACATGCGTGCGTTTGCTCGAGCAAACGCACGCATGTTCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139075.1-926s1c1
Sequence:CCGGCGATGTGATGATTCCTGCGTACTCGAGTACGCAGGAATCATCACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_139075.1-324s1c1
Sequence:CCGGCGACGGTATTACTCGAACGTACTCGAGTACGTTCGAGTAATACCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_139075.1-1307s1c1
Sequence:CCGGGCTTGACAGAAGTGTGGTTAACTCGAGTTAACCACACTTCTGTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_139075.1-1739s1c1
Sequence:CCGGGCTGAACATGCTCATCGTGTTCTCGAGAACACGATGAGCATGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_139075.1-2102s1c1
Sequence:CCGGCCCGTGGTCCAAGATCTATTTCTCGAGAAATAGATCTTGGACCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139075
VALIDATED
TPCN2 MISSION shRNA Lentiviral Transduction Particles
two pore segment channel 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139075.3-1361s21c1
Sequence:CCGGCGAGTACCAGTCTCCGTTTCTCTCGAGAGAAACGGAGACTGGTACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139075.3-2083s21c1
Sequence:CCGGAGGTGTTTCTGGATGCATATCCTCGAGGATATGCATCCAGAAACACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139075.3-267s21c1
Sequence:CCGGGTCTTCATCGAAGATGCTATTCTCGAGAATAGCATCTTCGATGAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139075.3-1843s21c1
Sequence:CCGGTGCAGAACATGCGTGCGTTTGCTCGAGCAAACGCACGCATGTTCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139075.1-926s1c1
Sequence:CCGGCGATGTGATGATTCCTGCGTACTCGAGTACGCAGGAATCATCACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_139075.1-324s1c1
Sequence:CCGGCGACGGTATTACTCGAACGTACTCGAGTACGTTCGAGTAATACCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_139075.1-1307s1c1
Sequence:CCGGGCTTGACAGAAGTGTGGTTAACTCGAGTTAACCACACTTCTGTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_139075.1-1739s1c1
Sequence:CCGGGCTGAACATGCTCATCGTGTTCTCGAGAACACGATGAGCATGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_139075.1-2102s1c1
Sequence:CCGGCCCGTGGTCCAAGATCTATTTCTCGAGAAATAGATCTTGGACCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146206
TPCN2 MISSION shRNA Bacterial Glycerol Stock
two pore segment channel 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146206.2-1863s1c1
Sequence:CCGGCCCAACAACTTTGACGACTTTCTCGAGAAAGTCGTCAAAGTTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146206.2-120s1c1
Sequence:CCGGGTCTTCATTGAAGACGCCATACTCGAGTATGGCGTCTTCAATGAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146206.2-447s1c1
Sequence:CCGGGCCTACTTTATGGTGCTGGTTCTCGAGAACCAGCACCATAAAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146206.2-1602s1c1
Sequence:CCGGCGACTGATGAACACACTGATTCTCGAGAATCAGTGTGTTCATCAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146206.2-1967s1c1
Sequence:CCGGCCCGTGGTCAATGGTGTATTTCTCGAGAAATACACCATTGACCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146206
TPCN2 MISSION shRNA shRNA Plasmid DNA
two pore segment channel 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146206.2-1863s1c1
Sequence:CCGGCCCAACAACTTTGACGACTTTCTCGAGAAAGTCGTCAAAGTTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146206.2-120s1c1
Sequence:CCGGGTCTTCATTGAAGACGCCATACTCGAGTATGGCGTCTTCAATGAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146206.2-447s1c1
Sequence:CCGGGCCTACTTTATGGTGCTGGTTCTCGAGAACCAGCACCATAAAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146206.2-1602s1c1
Sequence:CCGGCGACTGATGAACACACTGATTCTCGAGAATCAGTGTGTTCATCAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146206.2-1967s1c1
Sequence:CCGGCCCGTGGTCAATGGTGTATTTCTCGAGAAATACACCATTGACCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146206
TPCN2 MISSION shRNA Lentiviral Transduction Particles
two pore segment channel 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146206.2-1863s1c1
Sequence:CCGGCCCAACAACTTTGACGACTTTCTCGAGAAAGTCGTCAAAGTTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146206.2-120s1c1
Sequence:CCGGGTCTTCATTGAAGACGCCATACTCGAGTATGGCGTCTTCAATGAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146206.2-447s1c1
Sequence:CCGGGCCTACTTTATGGTGCTGGTTCTCGAGAACCAGCACCATAAAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146206.2-1602s1c1
Sequence:CCGGCGACTGATGAACACACTGATTCTCGAGAATCAGTGTGTTCATCAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146206.2-1967s1c1
Sequence:CCGGCCCGTGGTCAATGGTGTATTTCTCGAGAAATACACCATTGACCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks