EMAIL THIS PAGE TO A FRIEND

TPD52

tumor protein D52

Synonyms: D52 N8L PC-1 PrLZ hD52
Gene ID:
Mouse(21985) tumor protein D52
Rat(294900) tumor protein D52
Zebrafish(559992) tumor protein D52
chicken(770339) tumor protein D52
domestic cat(101085690) tumor protein D52
dog(477920) tumor protein D52
domestic guinea pig(100733659) tumor protein D52
Domestic Rabbit(100009212) tumor protein D52
naked mole-rat(101710649) tumor protein D52
cow(540235) tumor protein D52
sheep(101112068) tumor protein D52
223 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1100945 Anti-TPD52 (146-158) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB1100944 Anti-TPD52 (78-90) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB2501051 Anti-TPD52 antibody produced in goat affinity isolated antibody, buffered aqueous solution human, canine
ELISA, western blot pricing
SAB1406546 Anti-TPD52 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB2102519 Anti-TPD52 antibody produced in rabbit affinity isolated antibody horse, guinea pig, bovine, human, mouse, rat, rabbit, zebrafish, rabbit
western blot pricing
HPA062167 Anti-TPD52 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
HPA028427 Anti-TPD52 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB4503026 Anti-TPD52 antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, immunohistochemistry pricing
SAB1400283 Monoclonal Anti-TPD52 antibody produced in mouse clone 1B6, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0900 AQUA Peptide LGISSLQEF[K] mouse pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005079 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005079 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005079 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009412 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009412 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009412 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001025252 Rosetta Predictions human pricing
NM_001025253 Rosetta Predictions human pricing
NM_005079 Rosetta Predictions human pricing
NM_001106421 Rosetta Predictions rat pricing
NM_001025261 Rosetta Predictions mouse pricing
NM_001025262 Rosetta Predictions mouse pricing
NM_001025263 Rosetta Predictions mouse pricing
NM_001025264 Rosetta Predictions mouse pricing
NM_009412 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025252 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00170503 predicted 1045
2 SASI_Hs01_00170504 predicted 1122
3 SASI_Hs01_00170505 predicted 1154
4 SASI_Hs01_00170506 predicted 1261
5 SASI_Hs01_00170507 predicted 1475
6 SASI_Hs01_00170508 predicted 1264
7 SASI_Hs01_00170509 predicted 1029
8 SASI_Hs01_00170510 predicted 1169
9 SASI_Hs01_00170511 predicted 1422
10 SASI_Hs01_00170512 predicted 1370
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025253 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00180557 predicted 834
2 SASI_Hs01_00180558 predicted 905
3 SASI_Hs01_00180559 predicted 943
4 SASI_Hs01_00180560 predicted 1048
5 SASI_Hs01_00180561 predicted 1261
6 SASI_Hs01_00180562 predicted 1047
7 SASI_Hs01_00180563 predicted 816
8 SASI_Hs01_00180564 predicted 952
9 SASI_Hs01_00180565 predicted 1209
10 SASI_Hs01_00180566 predicted 1158
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005079 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00223055 predicted 759
2 SASI_Hs01_00223056 predicted 841
3 SASI_Hs01_00223057 predicted 876
4 SASI_Hs01_00223058 predicted 980
5 SASI_Hs01_00223059 predicted 1192
6 SASI_Hs01_00223060 predicted 978
7 SASI_Hs01_00223061 predicted 744
8 SASI_Hs01_00223062 predicted 885
9 SASI_Hs01_00223063 predicted 1144
10 SASI_Hs01_00223064 predicted 1091
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106421 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00218798 predicted 534
2 SASI_Rn02_00218799 predicted 258
3 SASI_Rn02_00218800 predicted 356
4 SASI_Rn02_00218801 predicted 428
5 SASI_Rn02_00218802 predicted 266
6 SASI_Rn02_00218803 predicted 534
7 SASI_Rn02_00218804 predicted 364
8 SASI_Rn02_00218805 predicted 198
9 SASI_Rn02_00218806 predicted 382
10 SASI_Rn02_00218807 predicted 403
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025261 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00149111 predicted 934
2 SASI_Mm01_00149112 predicted 938
3 SASI_Mm01_00149113 predicted 1004
4 SASI_Mm01_00149115 predicted 600
5 SASI_Mm02_00287816 predicted 574
6 SASI_Mm01_00149116 predicted 1072
7 SASI_Mm01_00149117 predicted 1088
8 SASI_Mm01_00149118 predicted 480
9 SASI_Mm01_00149120 predicted 464
10 SASI_Mm02_00287817 predicted 1041
11 SASI_Mm01_00149114 predicted 994
12 SASI_Mm01_00149119 predicted 1111
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025262 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00192708 predicted 870
2 SASI_Mm01_00192709 predicted 868
3 SASI_Mm01_00192710 predicted 941
4 SASI_Mm01_00192712 predicted 1000
5 SASI_Mm01_00192713 predicted 1023
6 SASI_Mm01_00192714 predicted 484
7 SASI_Mm01_00192716 predicted 464
8 SASI_Mm01_00192717 predicted 970
9 SASI_Mm02_00287818 predicted 935
10 SASI_Mm02_00287819 predicted 999
11 SASI_Mm01_00192711 predicted 931
12 SASI_Mm01_00192715 predicted 1044
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025263 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00068123 predicted 810
2 SASI_Mm01_00068124 predicted 813
3 SASI_Mm01_00068125 predicted 887
4 SASI_Mm01_00068127 predicted 1034
5 SASI_Mm01_00068128 predicted 479
6 SASI_Mm01_00068129 predicted 944
7 SASI_Mm01_00068130 predicted 1164
8 SASI_Mm01_00068131 predicted 970
9 SASI_Mm02_00287820 predicted 373
10 SASI_Mm02_00287821 predicted 911
11 SASI_Mm01_00068126 predicted 871
12 SASI_Mm01_00068132 predicted 980
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025264 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00059448 predicted 796
2 SASI_Mm01_00059449 predicted 796
3 SASI_Mm01_00059450 predicted 870
4 SASI_Mm01_00059452 predicted 1015
5 SASI_Mm01_00059453 predicted 930
6 SASI_Mm01_00059454 predicted 1152
7 SASI_Mm01_00059455 predicted 954
8 SASI_Mm01_00059451 predicted 853
9 SASI_Mm01_00059457 predicted 367
10 SASI_Mm02_00287822 predicted 896
11 SASI_Mm01_00059456 predicted 972
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009412 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00020596 predicted 776
2 SASI_Mm01_00020597 predicted 773
3 SASI_Mm01_00020598 predicted 836
4 SASI_Mm01_00020600 predicted 996
5 SASI_Mm01_00020601 predicted 901
6 SASI_Mm01_00020602 predicted 1129
7 SASI_Mm01_00020603 predicted 926
8 SASI_Mm01_00020599 predicted 822
9 SASI_Mm01_00020605 predicted 370
10 SASI_Mm02_00316062 predicted 871
11 SASI_Mm01_00020604 predicted 944
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005079
VALIDATED
TPD52 MISSION shRNA Bacterial Glycerol Stock
tumor protein D52
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005079.1-134s1c1
Sequence:CCGGCCTGAGGAAGGAGAAGATGTTCTCGAGAACATCTTCTCCTTCCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_005079.1-205s1c1
Sequence:CCGGGCTAAGAAGAGAACTTGCAAACTCGAGTTTGCAAGTTCTCTTCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159699    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_005079.1-1882s1c1
Sequence:CCGGGCCTACAATGTTGTATTTGTTCTCGAGAACAAATACAACATTGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005079.1-374s1c1
Sequence:CCGGGCTTACAAGAAGACATCTGAACTCGAGTTCAGATGTCTTCTTGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159219    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_005079.1-1024s1c1
Sequence:CCGGCCTCTTTGAATCTCTGTATATCTCGAGATATACAGAGATTCAAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159552    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_005079.1-1023s1c1
Sequence:CCGGCCCTCTTTGAATCTCTGTATACTCGAGTATACAGAGATTCAAAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_005079.1-200s1c1
Sequence:CCGGGAAGAGCTAAGAAGAGAACTTCTCGAGAAGTTCTCTTCTTAGCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005079.1-274s1c1
Sequence:CCGGGAAGCATCTAGCAGAGATCAACTCGAGTTGATCTCTGCTAGATGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005079.1-292s1c1
Sequence:CCGGCAAGCGGAAACTTGGAATCAACTCGAGTTGATTCCAAGTTTCCGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005079.1-284s1c1
Sequence:CCGGGCAGAGATCAAGCGGAAACTTCTCGAGAAGTTTCCGCTTGATCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005079.2-201s21c1
Sequence:CCGGCCTGAGGAAGGAGAAGATGTTCTCGAGAACATCTTCTCCTTCCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005079.2-267s21c1
Sequence:CCGGGAAGAGCTAAGAAGAGAACTTCTCGAGAAGTTCTCTTCTTAGCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005079.2-341s21c1
Sequence:CCGGGAAGCATCTAGCAGAGATCAACTCGAGTTGATCTCTGCTAGATGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005079.2-351s21c1
Sequence:CCGGGCAGAGATCAAGCGGAAACTTCTCGAGAAGTTTCCGCTTGATCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005079
VALIDATED
TPD52 MISSION shRNA shRNA Plasmid DNA
tumor protein D52
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005079.1-134s1c1
Sequence:CCGGCCTGAGGAAGGAGAAGATGTTCTCGAGAACATCTTCTCCTTCCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_005079.1-205s1c1
Sequence:CCGGGCTAAGAAGAGAACTTGCAAACTCGAGTTTGCAAGTTCTCTTCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159699    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_005079.1-1882s1c1
Sequence:CCGGGCCTACAATGTTGTATTTGTTCTCGAGAACAAATACAACATTGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005079.1-374s1c1
Sequence:CCGGGCTTACAAGAAGACATCTGAACTCGAGTTCAGATGTCTTCTTGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159219    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_005079.1-1024s1c1
Sequence:CCGGCCTCTTTGAATCTCTGTATATCTCGAGATATACAGAGATTCAAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159552    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_005079.1-1023s1c1
Sequence:CCGGCCCTCTTTGAATCTCTGTATACTCGAGTATACAGAGATTCAAAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_005079.1-200s1c1
Sequence:CCGGGAAGAGCTAAGAAGAGAACTTCTCGAGAAGTTCTCTTCTTAGCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005079.1-274s1c1
Sequence:CCGGGAAGCATCTAGCAGAGATCAACTCGAGTTGATCTCTGCTAGATGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005079.1-292s1c1
Sequence:CCGGCAAGCGGAAACTTGGAATCAACTCGAGTTGATTCCAAGTTTCCGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005079.1-284s1c1
Sequence:CCGGGCAGAGATCAAGCGGAAACTTCTCGAGAAGTTTCCGCTTGATCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005079.2-201s21c1
Sequence:CCGGCCTGAGGAAGGAGAAGATGTTCTCGAGAACATCTTCTCCTTCCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005079.2-267s21c1
Sequence:CCGGGAAGAGCTAAGAAGAGAACTTCTCGAGAAGTTCTCTTCTTAGCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005079.2-341s21c1
Sequence:CCGGGAAGCATCTAGCAGAGATCAACTCGAGTTGATCTCTGCTAGATGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005079.2-351s21c1
Sequence:CCGGGCAGAGATCAAGCGGAAACTTCTCGAGAAGTTTCCGCTTGATCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005079
VALIDATED
TPD52 MISSION shRNA Lentiviral Transduction Particles
tumor protein D52
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005079.1-134s1c1
Sequence:CCGGCCTGAGGAAGGAGAAGATGTTCTCGAGAACATCTTCTCCTTCCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_005079.1-205s1c1
Sequence:CCGGGCTAAGAAGAGAACTTGCAAACTCGAGTTTGCAAGTTCTCTTCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159699    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_005079.1-1882s1c1
Sequence:CCGGGCCTACAATGTTGTATTTGTTCTCGAGAACAAATACAACATTGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005079.1-374s1c1
Sequence:CCGGGCTTACAAGAAGACATCTGAACTCGAGTTCAGATGTCTTCTTGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159219    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_005079.1-1024s1c1
Sequence:CCGGCCTCTTTGAATCTCTGTATATCTCGAGATATACAGAGATTCAAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159552    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_005079.1-1023s1c1
Sequence:CCGGCCCTCTTTGAATCTCTGTATACTCGAGTATACAGAGATTCAAAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_005079.1-200s1c1
Sequence:CCGGGAAGAGCTAAGAAGAGAACTTCTCGAGAAGTTCTCTTCTTAGCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005079.1-274s1c1
Sequence:CCGGGAAGCATCTAGCAGAGATCAACTCGAGTTGATCTCTGCTAGATGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005079.1-292s1c1
Sequence:CCGGCAAGCGGAAACTTGGAATCAACTCGAGTTGATTCCAAGTTTCCGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005079.1-284s1c1
Sequence:CCGGGCAGAGATCAAGCGGAAACTTCTCGAGAAGTTTCCGCTTGATCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005079.2-201s21c1
Sequence:CCGGCCTGAGGAAGGAGAAGATGTTCTCGAGAACATCTTCTCCTTCCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005079.2-267s21c1
Sequence:CCGGGAAGAGCTAAGAAGAGAACTTCTCGAGAAGTTCTCTTCTTAGCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005079.2-341s21c1
Sequence:CCGGGAAGCATCTAGCAGAGATCAACTCGAGTTGATCTCTGCTAGATGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005079.2-351s21c1
Sequence:CCGGGCAGAGATCAAGCGGAAACTTCTCGAGAAGTTTCCGCTTGATCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009412
VALIDATED
TPD52 MISSION shRNA Bacterial Glycerol Stock
tumor protein D52
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000011853    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009412.1-1455s1c1
Sequence:CCGGGCCTCCATTAAATCCATTTAACTCGAGTTAAATGGATTTAATGGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009412.1-512s1c1
Sequence:CCGGCCACAGCCAACGCTACCAGTACTCGAGTACTGGTAGCGTTGGCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009412.1-171s1c1
Sequence:CCGGCCAGACTCTGTCCCAAGTATTCTCGAGAATACTTGGGACAGAGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009412.1-304s1c1
Sequence:CCGGGCATACAAGAAGACCTCTGAACTCGAGTTCAGAGGTCTTCTTGTATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009412.1-370s1c1
Sequence:CCGGGTTGGCTCAGTCATCACCAAACTCGAGTTTGGTGATGACTGAGCCAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009412.2-583s21c1
Sequence:CCGGCCACAGCCAACGCTACCAGTACTCGAGTACTGGTAGCGTTGGCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009412.2-375s21c1
Sequence:CCGGGCATACAAGAAGACCTCTGAACTCGAGTTCAGAGGTCTTCTTGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273014    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009412.2-965s21c1
Sequence:CCGGTACTATCTACATGAATCATTGCTCGAGCAATGATTCATGTAGATAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009412.2-242s21c1
Sequence:CCGGCCAGACTCTGTCCCAAGTATTCTCGAGAATACTTGGGACAGAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009412
VALIDATED
TPD52 MISSION shRNA shRNA Plasmid DNA
tumor protein D52
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000011853    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009412.1-1455s1c1
Sequence:CCGGGCCTCCATTAAATCCATTTAACTCGAGTTAAATGGATTTAATGGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009412.1-512s1c1
Sequence:CCGGCCACAGCCAACGCTACCAGTACTCGAGTACTGGTAGCGTTGGCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009412.1-171s1c1
Sequence:CCGGCCAGACTCTGTCCCAAGTATTCTCGAGAATACTTGGGACAGAGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009412.1-304s1c1
Sequence:CCGGGCATACAAGAAGACCTCTGAACTCGAGTTCAGAGGTCTTCTTGTATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009412.1-370s1c1
Sequence:CCGGGTTGGCTCAGTCATCACCAAACTCGAGTTTGGTGATGACTGAGCCAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009412.2-583s21c1
Sequence:CCGGCCACAGCCAACGCTACCAGTACTCGAGTACTGGTAGCGTTGGCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009412.2-375s21c1
Sequence:CCGGGCATACAAGAAGACCTCTGAACTCGAGTTCAGAGGTCTTCTTGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273014    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009412.2-965s21c1
Sequence:CCGGTACTATCTACATGAATCATTGCTCGAGCAATGATTCATGTAGATAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009412.2-242s21c1
Sequence:CCGGCCAGACTCTGTCCCAAGTATTCTCGAGAATACTTGGGACAGAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009412
VALIDATED
TPD52 MISSION shRNA Lentiviral Transduction Particles
tumor protein D52
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000011853    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009412.1-1455s1c1
Sequence:CCGGGCCTCCATTAAATCCATTTAACTCGAGTTAAATGGATTTAATGGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009412.1-512s1c1
Sequence:CCGGCCACAGCCAACGCTACCAGTACTCGAGTACTGGTAGCGTTGGCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009412.1-171s1c1
Sequence:CCGGCCAGACTCTGTCCCAAGTATTCTCGAGAATACTTGGGACAGAGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009412.1-304s1c1
Sequence:CCGGGCATACAAGAAGACCTCTGAACTCGAGTTCAGAGGTCTTCTTGTATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009412.1-370s1c1
Sequence:CCGGGTTGGCTCAGTCATCACCAAACTCGAGTTTGGTGATGACTGAGCCAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009412.2-583s21c1
Sequence:CCGGCCACAGCCAACGCTACCAGTACTCGAGTACTGGTAGCGTTGGCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009412.2-375s21c1
Sequence:CCGGGCATACAAGAAGACCTCTGAACTCGAGTTCAGAGGTCTTCTTGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273014    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009412.2-965s21c1
Sequence:CCGGTACTATCTACATGAATCATTGCTCGAGCAATGATTCATGTAGATAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009412.2-242s21c1
Sequence:CCGGCCAGACTCTGTCCCAAGTATTCTCGAGAATACTTGGGACAGAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks